Incidental Mutation 'R8202:St3gal3'
ID 635702
Institutional Source Beutler Lab
Gene Symbol St3gal3
Ensembl Gene ENSMUSG00000028538
Gene Name ST3 beta-galactoside alpha-2,3-sialyltransferase 3
Synonyms Siat6, Siat3, ST3Gal III
MMRRC Submission
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8202 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 117932154-118134914 bp(-) (GRCm38)
Type of Mutation start gained
DNA Base Change (assembly) T to A at 118107671 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102018 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030263] [ENSMUST00000097912] [ENSMUST00000106410]
AlphaFold P97325
Predicted Effect probably benign
Transcript: ENSMUST00000030263
SMART Domains Protein: ENSMUSP00000030263
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 102 373 5.7e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097912
SMART Domains Protein: ENSMUSP00000095525
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Pfam:Glyco_transf_29 86 357 5.4e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106410
SMART Domains Protein: ENSMUSP00000102018
Gene: ENSMUSG00000028538

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 37 47 N/A INTRINSIC
Pfam:Glyco_transf_29 106 372 4.7e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to galactose-containing substrates. The encoded protein is normally found in the Golgi apparatus but can be proteolytically processed to a soluble form. This protein is a member of glycosyltransferase family 29. Mutations in this gene have been associated with autosomal recessive nonsymdromic mental retardation-12 (MRT12). Multiple transcript variants encoding several different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for disruptions in this gene show an apparently normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in St3gal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01933:St3gal3 APN 4 118031875 missense probably damaging 1.00
IGL02004:St3gal3 APN 4 117960039 missense possibly damaging 0.90
IGL02339:St3gal3 APN 4 117958562 missense probably damaging 1.00
IGL03186:St3gal3 APN 4 117940054 missense possibly damaging 0.93
giovanni UTSW 4 117960007 missense possibly damaging 0.84
Leporello UTSW 4 117957436 missense
R0598:St3gal3 UTSW 4 118107632 missense probably benign 0.38
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1466:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1474:St3gal3 UTSW 4 118014786 missense probably damaging 1.00
R1584:St3gal3 UTSW 4 118107662 start codon destroyed probably null
R1585:St3gal3 UTSW 4 117960007 missense possibly damaging 0.84
R1696:St3gal3 UTSW 4 117940392 missense possibly damaging 0.52
R1735:St3gal3 UTSW 4 118014774 missense probably damaging 1.00
R1958:St3gal3 UTSW 4 117940071 missense probably damaging 0.96
R4008:St3gal3 UTSW 4 117940440 missense probably benign 0.34
R4700:St3gal3 UTSW 4 117960035 missense probably benign 0.01
R5434:St3gal3 UTSW 4 117940050 missense probably damaging 1.00
R6257:St3gal3 UTSW 4 118107678 start gained probably benign
R6854:St3gal3 UTSW 4 117958530 missense probably benign 0.00
R7218:St3gal3 UTSW 4 117957442 missense
R7304:St3gal3 UTSW 4 117957436 missense
R7569:St3gal3 UTSW 4 117964356 missense probably benign 0.09
R7783:St3gal3 UTSW 4 117940123 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CAACTAGAGCGGCGGTTTTAG -3'
(R):5'- AATCTGCCGTCCACAGGAAC -3'

Sequencing Primer
(F):5'- TATGCCTCCGTCCCGCAG -3'
(R):5'- CCGTCCACAGGAACAAGGAG -3'
Posted On 2020-07-13