Incidental Mutation 'R8202:Ceacam3'
ID635709
Institutional Source Beutler Lab
Gene Symbol Ceacam3
Ensembl Gene ENSMUSG00000053228
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 3
SynonymsEG384557, cea12, Psg24
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17150282-17164253 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17163028 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 640 (A640T)
Ref Sequence ENSEMBL: ENSMUSP00000104131 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108491]
Predicted Effect
SMART Domains Protein: ENSMUSP00000104131
Gene: ENSMUSG00000053228
AA Change: A640T

DomainStartEndE-ValueType
IG 40 141 2.83e-3 SMART
IG 160 261 6.31e-1 SMART
IG 280 379 8.01e-3 SMART
IG 398 497 2.08e-1 SMART
IG 514 613 1.26e0 SMART
IGc2 631 695 7.64e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Ceacam3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Ceacam3 APN 7 17151857 missense probably benign 0.03
IGL01510:Ceacam3 APN 7 17159842 missense probably benign 0.00
IGL01830:Ceacam3 APN 7 17155000 missense possibly damaging 0.79
IGL02155:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02281:Ceacam3 APN 7 17161731 missense probably benign 0.43
IGL02301:Ceacam3 APN 7 17163101 missense probably damaging 1.00
IGL02320:Ceacam3 APN 7 17161940 missense probably benign 0.43
IGL02514:Ceacam3 APN 7 17162981 missense possibly damaging 0.58
IGL02929:Ceacam3 APN 7 17158190 missense probably damaging 1.00
IGL03143:Ceacam3 APN 7 17158120 nonsense probably null
IGL03269:Ceacam3 APN 7 17161842 missense probably damaging 0.99
R0408:Ceacam3 UTSW 7 17151883 critical splice donor site probably benign
R0591:Ceacam3 UTSW 7 17151883 critical splice donor site probably null
R1274:Ceacam3 UTSW 7 17163139 missense probably damaging 0.98
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1376:Ceacam3 UTSW 7 17163163 missense probably damaging 1.00
R1490:Ceacam3 UTSW 7 17163146 missense probably damaging 1.00
R1635:Ceacam3 UTSW 7 17159977 missense probably damaging 1.00
R1769:Ceacam3 UTSW 7 17158376 missense probably damaging 1.00
R2345:Ceacam3 UTSW 7 17155000 missense possibly damaging 0.79
R2367:Ceacam3 UTSW 7 17151888 splice site probably null
R2403:Ceacam3 UTSW 7 17161854 missense probably damaging 1.00
R4030:Ceacam3 UTSW 7 17158342 missense probably benign 0.43
R4240:Ceacam3 UTSW 7 17160024 missense possibly damaging 0.95
R5305:Ceacam3 UTSW 7 17151576 missense probably damaging 1.00
R5314:Ceacam3 UTSW 7 17158371 missense possibly damaging 0.94
R5433:Ceacam3 UTSW 7 17159883 missense possibly damaging 0.48
R5538:Ceacam3 UTSW 7 17158421 missense probably damaging 1.00
R5638:Ceacam3 UTSW 7 17159935 missense probably damaging 0.98
R5787:Ceacam3 UTSW 7 17155046 missense possibly damaging 0.80
R5891:Ceacam3 UTSW 7 17151793 missense probably damaging 1.00
R5918:Ceacam3 UTSW 7 17159745 missense probably damaging 0.99
R6074:Ceacam3 UTSW 7 17151559 missense probably benign 0.05
R6386:Ceacam3 UTSW 7 17158219 missense probably benign 0.22
R6439:Ceacam3 UTSW 7 17158328 missense possibly damaging 0.59
R6455:Ceacam3 UTSW 7 17161938 missense possibly damaging 0.81
R7150:Ceacam3 UTSW 7 17151562 missense
R7196:Ceacam3 UTSW 7 17154956 missense
R7201:Ceacam3 UTSW 7 17158238 nonsense probably null
R7731:Ceacam3 UTSW 7 17158350 missense
R7833:Ceacam3 UTSW 7 17159853 missense
R8237:Ceacam3 UTSW 7 17163157 missense
R8420:Ceacam3 UTSW 7 17161683 missense
R8696:Ceacam3 UTSW 7 17160012 missense
Predicted Primers PCR Primer
(F):5'- AAGGTCTTCACGTTGGAGGC -3'
(R):5'- GAGGAGAGGTCACTCAATCAC -3'

Sequencing Primer
(F):5'- CTTCACGTTGGAGGCTCTTTTAG -3'
(R):5'- TCAGGCTGACTGGGAGACTG -3'
Posted On2020-07-13