Incidental Mutation 'R8202:Bckdha'
ID635711
Institutional Source Beutler Lab
Gene Symbol Bckdha
Ensembl Gene ENSMUSG00000060376
Gene Namebranched chain ketoacid dehydrogenase E1, alpha polypeptide
SynonymsBCKAD E1[a]
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R8202 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location25629946-25658981 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25630313 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 431 (H431Y)
Ref Sequence ENSEMBL: ENSMUSP00000071292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071329] [ENSMUST00000076034] [ENSMUST00000077338] [ENSMUST00000085953] [ENSMUST00000205281] [ENSMUST00000205808] [ENSMUST00000206940]
Predicted Effect probably damaging
Transcript: ENSMUST00000071329
AA Change: H431Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071292
Gene: ENSMUSG00000060376
AA Change: H431Y

DomainStartEndE-ValueType
low complexity region 14 36 N/A INTRINSIC
Pfam:E1_dh 107 407 2.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076034
SMART Domains Protein: ENSMUSP00000092277
Gene: ENSMUSG00000059479

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:Galactosyl_T 154 344 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000077338
SMART Domains Protein: ENSMUSP00000076563
Gene: ENSMUSG00000057229

DomainStartEndE-ValueType
PDB:3E4G|A 82 213 2e-10 PDB
SCOP:d1fqva2 109 209 2e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000085953
SMART Domains Protein: ENSMUSP00000083115
Gene: ENSMUSG00000057229

DomainStartEndE-ValueType
PDB:3E4G|A 81 212 3e-10 PDB
SCOP:d1fqva2 108 208 3e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000205281
Predicted Effect probably benign
Transcript: ENSMUST00000205808
Predicted Effect probably benign
Transcript: ENSMUST00000206940
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-keto acid (BCAA) dehydrogenase (BCKD) complex is an innter mitochondrial enzyme complex that catalyzes the second major step in the catabolism of the branched-chain amino acids leucine, isoleucine, and valine. The BCKD complex consists of three catalytic components: a heterotetrameric (alpha2-beta2) branched-chain alpha-keto acid decarboxylase (E1), a dihydrolipoyl transacylase (E2), and a dihydrolipoamide dehydrogenase (E3). This gene encodes the alpha subunit of the decarboxylase (E1) component. Mutations in this gene result in maple syrup urine disease, type IA. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rhox13 AGTGAGAGCGACTCGGAGAGTGAGAGCGACTCGGAGAGTGAGAGCGACTC AGTGAGAGCGACTCGGAGCGTGAGAGCGACTCGGAGAGTGAGAGCGACTCGGAGAGTGAGAGCGACTC X: 38,121,485 probably benign Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Other mutations in Bckdha
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Bckdha APN 7 25633342 missense probably benign 0.00
IGL01322:Bckdha APN 7 25658707 missense possibly damaging 0.75
IGL02279:Bckdha APN 7 25631109 missense probably damaging 1.00
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0071:Bckdha UTSW 7 25630443 splice site probably null
R0194:Bckdha UTSW 7 25631450 missense probably damaging 1.00
R0615:Bckdha UTSW 7 25641785 missense probably benign 0.00
R1806:Bckdha UTSW 7 25631420 missense probably damaging 1.00
R2520:Bckdha UTSW 7 25641699 missense probably benign 0.18
R3847:Bckdha UTSW 7 25631652 missense probably damaging 1.00
R3975:Bckdha UTSW 7 25631433 missense probably damaging 1.00
R4630:Bckdha UTSW 7 25631459 missense probably damaging 1.00
R5655:Bckdha UTSW 7 25630364 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R6030:Bckdha UTSW 7 25631441 missense probably damaging 1.00
R7961:Bckdha UTSW 7 25631478 missense probably damaging 1.00
R8344:Bckdha UTSW 7 25631447 missense probably damaging 1.00
Z1176:Bckdha UTSW 7 25631143 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGTGCCCCAGTGAAGTAG -3'
(R):5'- ATTAACACCAGTCTGAGGCC -3'

Sequencing Primer
(F):5'- CCAGTGAAGTAGCCTGGGG -3'
(R):5'- TGAGGCCTCAGAGGGGTG -3'
Posted On2020-07-13