Incidental Mutation 'R8202:Olfr645'
ID635714
Institutional Source Beutler Lab
Gene Symbol Olfr645
Ensembl Gene ENSMUSG00000051340
Gene Nameolfactory receptor 645
SynonymsGA_x6K02T2PBJ9-6819097-6818150, MOR13-5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104081789-104085465 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104084991 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 30 (S30P)
Ref Sequence ENSEMBL: ENSMUSP00000062821 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057104] [ENSMUST00000138055]
Predicted Effect probably benign
Transcript: ENSMUST00000057104
AA Change: S30P

PolyPhen 2 Score 0.199 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000062821
Gene: ENSMUSG00000051340
AA Change: S30P

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 5.4e-113 PFAM
Pfam:7TM_GPCR_Srsx 37 256 8e-8 PFAM
Pfam:7tm_1 43 295 5.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138055
SMART Domains Protein: ENSMUSP00000139240
Gene: ENSMUSG00000109824

DomainStartEndE-ValueType
transmembrane domain 29 51 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Olfr645
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1303:Olfr645 UTSW 7 104084741 missense probably damaging 1.00
R1488:Olfr645 UTSW 7 104084652 missense probably benign
R1556:Olfr645 UTSW 7 104084261 missense probably benign
R2158:Olfr645 UTSW 7 104084826 missense probably benign
R2987:Olfr645 UTSW 7 104084870 missense probably benign 0.01
R4437:Olfr645 UTSW 7 104084921 missense possibly damaging 0.88
R4773:Olfr645 UTSW 7 104084295 missense probably damaging 1.00
R5285:Olfr645 UTSW 7 104084133 makesense probably null
R5396:Olfr645 UTSW 7 104084891 missense probably benign 0.08
R5516:Olfr645 UTSW 7 104084237 missense possibly damaging 0.53
R5761:Olfr645 UTSW 7 104084169 missense probably benign 0.01
R5793:Olfr645 UTSW 7 104085030 missense probably benign 0.10
R5960:Olfr645 UTSW 7 104084353 missense probably damaging 1.00
R6242:Olfr645 UTSW 7 104084564 missense possibly damaging 0.82
R6676:Olfr645 UTSW 7 104084454 missense probably benign 0.02
R6975:Olfr645 UTSW 7 104084795 missense probably benign
Predicted Primers PCR Primer
(F):5'- ATTAAAGTTGATCACTCGGGCATG -3'
(R):5'- AAATCTATGTGCTGCCGCC -3'

Sequencing Primer
(F):5'- TGATCACTCGGGCATGGAAGC -3'
(R):5'- GCCGCCTTTCCTTCCATAGG -3'
Posted On2020-07-13