Incidental Mutation 'R8202:Trim3'
ID635715
Institutional Source Beutler Lab
Gene Symbol Trim3
Ensembl Gene ENSMUSG00000036989
Gene Nametripartite motif-containing 3
SynonymsHAC1, Rnf22, BERP1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location105604463-105633571 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105611425 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 662 (H662Q)
Ref Sequence ENSEMBL: ENSMUSP00000053384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057525] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000147044]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057525
AA Change: H662Q

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989
AA Change: H662Q

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000106789
AA Change: H662Q

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989
AA Change: H662Q

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
AA Change: H662Q

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989
AA Change: H662Q

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000147044
AA Change: H662Q

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989
AA Change: H662Q

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family, also called the 'RING-B-box-coiled-coil' (RBCC) subgroup of RING finger proteins. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic filaments. It is similar to a rat protein which is a specific partner for the tail domain of myosin V, a class of myosins which are involved in the targeted transport of organelles. The rat protein can also interact with alpha-actinin-4. Thus it is suggested that this human protein may play a role in myosin V-mediated cargo transport. Alternatively spliced transcript variants encoding the same isoform have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele have decreased susceptibility to pharmacologically induced seizure as well as reduced miniature inhibitory synaptic current amplitude in cortical neurons. Mice homozygous for another null allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Trim3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Trim3 APN 7 105617469 missense probably damaging 1.00
IGL01543:Trim3 APN 7 105613313 missense probably damaging 1.00
IGL01573:Trim3 APN 7 105625493 missense possibly damaging 0.62
IGL01995:Trim3 APN 7 105618482 splice site probably benign
IGL02407:Trim3 APN 7 105613011 missense probably benign 0.44
IGL02868:Trim3 APN 7 105613032 missense possibly damaging 0.82
IGL02837:Trim3 UTSW 7 105612656 missense probably damaging 1.00
PIT4514001:Trim3 UTSW 7 105618210 missense probably benign 0.08
R1013:Trim3 UTSW 7 105617895 missense probably benign 0.10
R2296:Trim3 UTSW 7 105613274 missense probably damaging 1.00
R3724:Trim3 UTSW 7 105611189 missense probably damaging 1.00
R4028:Trim3 UTSW 7 105618245 missense probably benign 0.04
R4347:Trim3 UTSW 7 105619387 missense probably damaging 1.00
R4383:Trim3 UTSW 7 105618399 missense probably damaging 1.00
R4475:Trim3 UTSW 7 105617802 missense probably damaging 1.00
R4567:Trim3 UTSW 7 105613416 missense possibly damaging 0.88
R4886:Trim3 UTSW 7 105617840 missense probably damaging 1.00
R4981:Trim3 UTSW 7 105619128 missense probably damaging 0.99
R5053:Trim3 UTSW 7 105617761 missense probably damaging 1.00
R5190:Trim3 UTSW 7 105619509 missense probably damaging 1.00
R5230:Trim3 UTSW 7 105619513 missense possibly damaging 0.81
R5364:Trim3 UTSW 7 105619069 missense probably damaging 0.96
R5382:Trim3 UTSW 7 105618347 missense probably benign 0.10
R5712:Trim3 UTSW 7 105619536 missense probably damaging 0.99
R5725:Trim3 UTSW 7 105617740 critical splice donor site probably null
R5915:Trim3 UTSW 7 105617975 missense possibly damaging 0.82
R6058:Trim3 UTSW 7 105611071 missense probably damaging 0.98
R6073:Trim3 UTSW 7 105617539 missense probably damaging 1.00
R6430:Trim3 UTSW 7 105618005 missense probably benign 0.20
R6589:Trim3 UTSW 7 105617960 missense probably damaging 1.00
R7044:Trim3 UTSW 7 105618214 missense probably damaging 0.97
R7207:Trim3 UTSW 7 105613376 missense possibly damaging 0.87
R7326:Trim3 UTSW 7 105617800 nonsense probably null
R7454:Trim3 UTSW 7 105619558 missense probably damaging 1.00
R7459:Trim3 UTSW 7 105617808 missense probably damaging 1.00
R8044:Trim3 UTSW 7 105613258 synonymous silent
Predicted Primers PCR Primer
(F):5'- AGAGCTGTCGAATACCTGGG -3'
(R):5'- ATCCCTGGGAAGAATTTCTGGG -3'

Sequencing Primer
(F):5'- CTGTCGAATACCTGGGGAAGAC -3'
(R):5'- TCTGGGCTAAGCTAAAGATCTG -3'
Posted On2020-07-13