Incidental Mutation 'R8202:Map10'
ID635717
Institutional Source Beutler Lab
Gene Symbol Map10
Ensembl Gene ENSMUSG00000050930
Gene Namemicrotubule-associated protein 10
Synonyms4933403G14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8202 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location125669818-125673359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 125670908 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 347 (N347D)
Ref Sequence ENSEMBL: ENSMUSP00000061679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053078]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053078
AA Change: N347D

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000061679
Gene: ENSMUSG00000050930
AA Change: N347D

DomainStartEndE-ValueType
low complexity region 38 54 N/A INTRINSIC
low complexity region 68 91 N/A INTRINSIC
Pfam:HPHLAWLY 243 535 1.4e-130 PFAM
Pfam:HPHLAWLY 527 890 9.1e-133 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rhox13 AGTGAGAGCGACTCGGAGAGTGAGAGCGACTCGGAGAGTGAGAGCGACTC AGTGAGAGCGACTCGGAGCGTGAGAGCGACTCGGAGAGTGAGAGCGACTCGGAGAGTGAGAGCGACTC X: 38,121,485 probably benign Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Other mutations in Map10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Map10 APN 8 125671932 missense probably benign 0.00
IGL01567:Map10 APN 8 125671493 missense probably benign 0.32
IGL02566:Map10 APN 8 125671755 missense probably benign
IGL03088:Map10 APN 8 125671070 missense probably benign 0.14
debauched UTSW 8 125671245 missense probably damaging 1.00
R1083:Map10 UTSW 8 125670439 nonsense probably null
R1543:Map10 UTSW 8 125670872 missense probably benign 0.00
R3155:Map10 UTSW 8 125671574 missense possibly damaging 0.79
R4076:Map10 UTSW 8 125671845 missense probably benign 0.23
R4559:Map10 UTSW 8 125671814 missense probably benign
R4856:Map10 UTSW 8 125670692 missense probably damaging 1.00
R4886:Map10 UTSW 8 125670692 missense probably damaging 1.00
R5412:Map10 UTSW 8 125670985 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6034:Map10 UTSW 8 125672466 missense probably damaging 1.00
R6150:Map10 UTSW 8 125671589 missense probably damaging 0.96
R6351:Map10 UTSW 8 125671245 missense probably damaging 1.00
R6466:Map10 UTSW 8 125672384 nonsense probably null
R6544:Map10 UTSW 8 125671374 missense probably benign 0.00
R6557:Map10 UTSW 8 125670252 missense probably damaging 0.98
R6821:Map10 UTSW 8 125670399 missense probably benign 0.01
R7096:Map10 UTSW 8 125671923 missense probably damaging 0.99
R7128:Map10 UTSW 8 125671853 missense probably benign
R7177:Map10 UTSW 8 125671845 missense probably benign 0.23
R7237:Map10 UTSW 8 125671224 missense probably benign 0.03
R7814:Map10 UTSW 8 125671611 missense probably benign 0.14
R7819:Map10 UTSW 8 125670521 frame shift probably null
Z1088:Map10 UTSW 8 125671931 frame shift probably null
Z1177:Map10 UTSW 8 125670070 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCAGGGTTGAAATCACTATTG -3'
(R):5'- TGCTCTTTGATTCCGACGGG -3'

Sequencing Primer
(F):5'- GGGTTGAAATCACTATTGAGCCTCAG -3'
(R):5'- ATTCCGACGGGGATGTGGAC -3'
Posted On2020-07-13