Incidental Mutation 'R8202:Unc13c'
ID635719
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73736562 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1207 (V1207M)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: V1207M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: V1207M

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: V1207M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: V1207M

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
feeling UTSW 9 73693271 missense possibly damaging 0.46
Inkling UTSW 9 73931844 missense probably damaging 1.00
notion UTSW 9 73736562 missense probably damaging 1.00
BB001:Unc13c UTSW 9 73734408 missense probably benign 0.05
BB011:Unc13c UTSW 9 73734408 missense probably benign 0.05
PIT4431001:Unc13c UTSW 9 73749547 missense probably damaging 0.99
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7924:Unc13c UTSW 9 73734408 missense probably benign 0.05
R8047:Unc13c UTSW 9 73812354 nonsense probably null
R8167:Unc13c UTSW 9 73736703 missense probably damaging 0.99
R8210:Unc13c UTSW 9 73484938 missense probably benign 0.13
R8352:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8368:Unc13c UTSW 9 73930788 missense probably benign 0.15
R8452:Unc13c UTSW 9 73931008 missense probably damaging 0.99
R8535:Unc13c UTSW 9 73540371 missense probably benign
R8677:Unc13c UTSW 9 73932961 missense probably benign 0.00
R8700:Unc13c UTSW 9 73572397 missense probably benign 0.44
R8848:Unc13c UTSW 9 73525981 missense probably benign
R8902:Unc13c UTSW 9 73749548 missense probably damaging 0.97
R8953:Unc13c UTSW 9 73932762 missense probably benign 0.00
R8961:Unc13c UTSW 9 73932242 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCATTATTCAGTAGCAAGCAAC -3'
(R):5'- TCACTGACTTTCCACTGCAG -3'

Sequencing Primer
(F):5'- TTCAGTAGCAAGCAACTTGAAAAGC -3'
(R):5'- CAGGAGCAGCAGAGAAGAGCTC -3'
Posted On2020-07-13