Incidental Mutation 'R8202:Tmem30a'
ID635720
Institutional Source Beutler Lab
Gene Symbol Tmem30a
Ensembl Gene ENSMUSG00000032328
Gene Nametransmembrane protein 30A
SynonymsCdc50a, D9Wsu20e, 2010200I23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location79768943-79793507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79774212 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 261 (I261K)
Ref Sequence ENSEMBL: ENSMUSP00000034878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034878] [ENSMUST00000120690]
Predicted Effect probably damaging
Transcript: ENSMUST00000034878
AA Change: I261K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034878
Gene: ENSMUSG00000032328
AA Change: I261K

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Pfam:CDC50 69 358 1.3e-98 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120690
AA Change: I225K

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114042
Gene: ENSMUSG00000032328
AA Change: I225K

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
Pfam:CDC50 50 325 3.4e-92 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Conditional homozygous knockout in the liver leads to jaundice, increased bilirubin and bile salt levels, liver inflammation and liver fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Tmem30a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01300:Tmem30a APN 9 79775100 critical splice donor site probably null
IGL01701:Tmem30a APN 9 79774179 missense probably damaging 1.00
IGL02043:Tmem30a APN 9 79774089 splice site probably benign
IGL02319:Tmem30a APN 9 79774203 missense probably damaging 1.00
IGL02629:Tmem30a APN 9 79776249 splice site probably benign
IGL02983:Tmem30a APN 9 79771443 missense possibly damaging 0.90
Imbroglio UTSW 9 79774265 nonsense probably null
ladyfinger UTSW 9 79774212 missense probably damaging 1.00
R0085:Tmem30a UTSW 9 79771294 missense probably benign 0.02
R0496:Tmem30a UTSW 9 79777285 missense probably damaging 1.00
R0498:Tmem30a UTSW 9 79774094 nonsense probably null
R1546:Tmem30a UTSW 9 79771288 makesense probably null
R1648:Tmem30a UTSW 9 79793029 missense probably damaging 1.00
R2018:Tmem30a UTSW 9 79774218 missense probably damaging 1.00
R2019:Tmem30a UTSW 9 79774218 missense probably damaging 1.00
R2259:Tmem30a UTSW 9 79774164 missense probably benign 0.13
R2260:Tmem30a UTSW 9 79774164 missense probably benign 0.13
R4491:Tmem30a UTSW 9 79777285 missense probably damaging 1.00
R4492:Tmem30a UTSW 9 79777285 missense probably damaging 1.00
R5289:Tmem30a UTSW 9 79776154 missense probably damaging 0.99
R5433:Tmem30a UTSW 9 79780648 missense probably damaging 0.98
R6707:Tmem30a UTSW 9 79774265 nonsense probably null
R7662:Tmem30a UTSW 9 79775231 missense probably benign
R7732:Tmem30a UTSW 9 79780544 missense possibly damaging 0.49
R8100:Tmem30a UTSW 9 79774150 missense probably benign 0.00
R8413:Tmem30a UTSW 9 79776225 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGACCCTACATGAATCTAGAGC -3'
(R):5'- GACGTAATCTACCTTTCCTCAGGATC -3'

Sequencing Primer
(F):5'- GAATCTAGAGCACAAAGTAACATGTC -3'
(R):5'- AAGGAAATATTCAGATTGTTTTGTGC -3'
Posted On2020-07-13