Incidental Mutation 'R8202:Heatr6'
ID635726
Institutional Source Beutler Lab
Gene Symbol Heatr6
Ensembl Gene ENSMUSG00000000976
Gene NameHEAT repeat containing 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.722) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location83753696-83783754 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 83759408 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 230 (T230K)
Ref Sequence ENSEMBL: ENSMUSP00000001002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001002
AA Change: T230K

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000001002
Gene: ENSMUSG00000000976
AA Change: T230K

DomainStartEndE-ValueType
low complexity region 160 174 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
low complexity region 329 348 N/A INTRINSIC
low complexity region 391 402 N/A INTRINSIC
Pfam:DUF4042 421 602 9.6e-73 PFAM
low complexity region 603 627 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 1078 1091 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Heatr6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Heatr6 APN 11 83759309 missense probably damaging 1.00
IGL01681:Heatr6 APN 11 83765000 missense probably benign 0.08
IGL01905:Heatr6 APN 11 83781712 missense probably benign 0.06
IGL02037:Heatr6 APN 11 83764882 splice site probably benign
IGL02313:Heatr6 APN 11 83778892 missense probably damaging 1.00
IGL02652:Heatr6 APN 11 83769732 missense probably damaging 1.00
IGL03004:Heatr6 APN 11 83757379 missense probably benign 0.01
IGL03229:Heatr6 APN 11 83781445 missense probably benign 0.01
IGL03386:Heatr6 APN 11 83759377 missense probably damaging 1.00
IGL02802:Heatr6 UTSW 11 83760936 missense probably damaging 1.00
R0537:Heatr6 UTSW 11 83779464 nonsense probably null
R1658:Heatr6 UTSW 11 83758367 missense probably damaging 1.00
R1864:Heatr6 UTSW 11 83769230 missense probably damaging 0.97
R1893:Heatr6 UTSW 11 83757314 missense probably benign 0.33
R1944:Heatr6 UTSW 11 83769220 missense probably damaging 1.00
R2115:Heatr6 UTSW 11 83757455 unclassified probably benign
R3019:Heatr6 UTSW 11 83778832 splice site probably null
R4050:Heatr6 UTSW 11 83755773 missense probably damaging 0.99
R4532:Heatr6 UTSW 11 83769672 missense probably damaging 1.00
R4576:Heatr6 UTSW 11 83765000 missense probably benign 0.08
R4724:Heatr6 UTSW 11 83779548 nonsense probably null
R4825:Heatr6 UTSW 11 83758322 missense probably damaging 1.00
R5489:Heatr6 UTSW 11 83774432 missense probably damaging 1.00
R5970:Heatr6 UTSW 11 83753718 unclassified probably benign
R6136:Heatr6 UTSW 11 83772503 missense possibly damaging 0.94
R6145:Heatr6 UTSW 11 83766136 missense probably damaging 1.00
R6649:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6653:Heatr6 UTSW 11 83759365 missense probably benign 0.01
R6791:Heatr6 UTSW 11 83758341 missense probably benign
R6865:Heatr6 UTSW 11 83769140 missense probably damaging 1.00
R7154:Heatr6 UTSW 11 83777241 missense probably benign 0.05
R7385:Heatr6 UTSW 11 83759335 missense probably damaging 0.96
R7473:Heatr6 UTSW 11 83781391 missense probably damaging 1.00
R7959:Heatr6 UTSW 11 83781363 nonsense probably null
R8034:Heatr6 UTSW 11 83753909 missense probably benign 0.01
R8398:Heatr6 UTSW 11 83781338 missense probably benign 0.01
R8472:Heatr6 UTSW 11 83765853 missense probably benign 0.34
R8704:Heatr6 UTSW 11 83777278 missense probably benign 0.09
X0014:Heatr6 UTSW 11 83781250 missense probably damaging 0.97
Z1177:Heatr6 UTSW 11 83766081 missense probably benign 0.00
Z1177:Heatr6 UTSW 11 83781382 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTCCAGACTTAGCGGTC -3'
(R):5'- CCAAAGGTGTGACTTCAGTGC -3'

Sequencing Primer
(F):5'- GCATTGCCGTTGCTAATGC -3'
(R):5'- GTGCTGCTGACATATAGACACCATTC -3'
Posted On2020-07-13