Mutagenetix > Incidental Mutation

Incidental Mutation 'R8202:Pcnx'

635728

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8202 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 81895047 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 73 (I73S)

Ref Sequence

ENSEMBL: ENSMUSP00000021567 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567]

AlphaFold

Q9QYC1

Predicted Effect

probably benign
Transcript: ENSMUST00000021567
AA Change: I73S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: I73S

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	C	T	14: 36,095,100	R36C	probably benign	Het
B020011L13Rik	A	T	1: 117,801,144	H127L	probably damaging	Het
B4galt4	A	G	16: 38,767,912	Q306R	probably benign	Het
Bckdha	G	A	7: 25,630,313	H431Y	probably damaging	Het
Cacna1e	T	A	1: 154,398,449	M2256L	probably benign	Het
Ccar1	A	T	10: 62,771,989	F298L	possibly damaging	Het
Ceacam3	G	A	7: 17,163,028	A640T		Het
Cers3	A	G	7: 66,786,013	D240G	probably damaging	Het
Ces1d	T	C	8: 93,192,867	E99G	probably benign	Het
Dnah2	A	G	11: 69,478,823	V1609A	probably benign	Het
Fer1l6	T	C	15: 58,630,637	F1329S	probably damaging	Het
Fry	A	G	5: 150,431,737	Q1825R	probably damaging	Het
Guf1	C	A	5: 69,563,202	A335E	possibly damaging	Het
Heatr6	C	A	11: 83,759,408	T230K	possibly damaging	Het
Klhl11	G	A	11: 100,463,324	S557L	probably benign	Het
Map10	A	G	8: 125,670,908	N347D	possibly damaging	Het
Myh7	T	C	14: 54,990,040	I313V	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nmral1	G	A	16: 4,714,584	T131M	probably damaging	Het
Npr1	T	A	3: 90,461,424	Y443F	probably benign	Het
Ntn4	A	G	10: 93,644,903	N163S	possibly damaging	Het
Nufip1	A	G	14: 76,111,164	I78V	probably benign	Het
Olfr1052	A	T	2: 86,298,624	E269D	probably benign	Het
Olfr645	A	G	7: 104,084,991	S30P	probably benign	Het
Olfr810	T	C	10: 129,790,649	*313W	probably null	Het
Oplah	C	T	15: 76,302,469	G670D	probably benign	Het
Pigp	A	T	16: 94,364,669	N204K	probably benign	Het
Prelid2	T	A	18: 41,932,737	I78F	possibly damaging	Het
Ptprb	A	G	10: 116,353,845	Y1516C	probably damaging	Het
Rab31	T	C	17: 65,667,886	E157G	probably damaging	Het
Rars2	T	C	4: 34,656,180	Y445H	probably damaging	Het
Rnf220	T	A	4: 117,489,873	H114L	probably damaging	Het
Ryr1	A	G	7: 29,091,032	W1450R	probably benign	Het
Slamf6	A	G	1: 171,934,219	Y69C	probably benign	Het
Smc3	T	C	19: 53,628,692	I512T	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
St3gal3	T	A	4: 118,107,671		probably benign	Het
Tbc1d23	A	G	16: 57,191,554	F338L	probably damaging	Het
Tgs1	G	A	4: 3,586,097	A325T	probably benign	Het
Tmem30a	A	T	9: 79,774,212	I261K	probably damaging	Het
Trim3	A	T	7: 105,611,425	H662Q	possibly damaging	Het
Unc13c	C	T	9: 73,736,562	V1207M	probably damaging	Het
Vmn1r91	A	T	7: 20,101,824	I223F	probably damaging	Het
Vmn2r33	A	T	7: 7,554,154	C516S	possibly damaging	Het
Vps13c	T	C	9: 67,944,046	V2321A	probably damaging	Het
Zan	G	T	5: 137,389,327	T4874K	unknown	Het
Zfp677	T	C	17: 21,393,273	L43S	probably damaging	Het
Zfp709	A	G	8: 71,888,916		probably null	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0086:Pcnx	UTSW	12	81992058	unclassified	probably benign
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1774:Pcnx	UTSW	12	81975320	missense	probably damaging	1.00
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6753:Pcnx	UTSW	12	81964480	missense	probably damaging	1.00
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6778:Pcnx	UTSW	12	81918871	missense	probably damaging	1.00
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	splice site	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8021:Pcnx	UTSW	12	81918819	nonsense	probably null
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
R8078:Pcnx	UTSW	12	81975280	missense
R8093:Pcnx	UTSW	12	81918819	nonsense	probably null
R8104:Pcnx	UTSW	12	81983611	nonsense	probably null
R8108:Pcnx	UTSW	12	81918819	nonsense	probably null
R8109:Pcnx	UTSW	12	81918819	nonsense	probably null
R8131:Pcnx	UTSW	12	81918518	missense	possibly damaging	0.80
R8136:Pcnx	UTSW	12	81918006	missense	probably benign
R8153:Pcnx	UTSW	12	81918819	nonsense	probably null
R8156:Pcnx	UTSW	12	81918819	nonsense	probably null
R8362:Pcnx	UTSW	12	81967056	missense
R8515:Pcnx	UTSW	12	81962716	missense	possibly damaging	0.83
R8803:Pcnx	UTSW	12	81993151	missense	possibly damaging	0.85
R8820:Pcnx	UTSW	12	81973248	missense
R8828:Pcnx	UTSW	12	81995823	missense	probably damaging	1.00
R8946:Pcnx	UTSW	12	81971384	missense	probably damaging	0.96
R8964:Pcnx	UTSW	12	81993038	missense
R9152:Pcnx	UTSW	12	81975815	missense
R9256:Pcnx	UTSW	12	81973273	missense
R9287:Pcnx	UTSW	12	81995549	missense	probably benign	0.07
R9289:Pcnx	UTSW	12	81982079	missense
R9414:Pcnx	UTSW	12	81918204	missense	probably damaging	1.00
R9445:Pcnx	UTSW	12	81918207	missense	probably damaging	0.98
R9595:Pcnx	UTSW	12	81918914	missense
R9600:Pcnx	UTSW	12	81983661	missense
R9620:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- GGAGTCCTTTACTTTTGCAGCTTAG -3'
(R):5'- TGGACACAGTACTCACATTGTC -3'

Sequencing Primer
(F):5'- TGCAGCTTAGTATAATTGCTTCG -3'
(R):5'- GTCATTTACATCTACAAGGCAAGC -3'

Posted On

2020-07-13