Incidental Mutation 'R8202:Nufip1'
ID635731
Institutional Source Beutler Lab
Gene Symbol Nufip1
Ensembl Gene ENSMUSG00000022009
Gene Namenuclear fragile X mental retardation protein interacting protein 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location76110891-76137379 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76111164 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 78 (I78V)
Ref Sequence ENSEMBL: ENSMUSP00000022586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022585] [ENSMUST00000022586]
Predicted Effect probably benign
Transcript: ENSMUST00000022585
SMART Domains Protein: ENSMUSP00000022585
Gene: ENSMUSG00000022008

DomainStartEndE-ValueType
low complexity region 41 67 N/A INTRINSIC
low complexity region 105 117 N/A INTRINSIC
Pfam:DUF3752 202 338 8.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022586
AA Change: I78V

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022586
Gene: ENSMUSG00000022009
AA Change: I78V

DomainStartEndE-ValueType
low complexity region 38 48 N/A INTRINSIC
low complexity region 80 99 N/A INTRINSIC
ZnF_C2H2 165 187 3.58e-2 SMART
ZnF_C2H2 188 212 5.4e1 SMART
low complexity region 291 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear RNA binding protein that contains a C2H2 zinc finger motif and a nuclear localization signal. This protein is associated with the nuclear matrix in perichromatin fibrils and, in neurons, localizes to the cytoplasm in association with endoplasmic reticulum ribosomes. This protein interacts with the fragile X mental retardation protein (FMRP), the tumor suppressor protein BRCA1, upregulates RNA polymerase II transcription, and is involved in box C/D snoRNP biogenesis. A pseudogene of this gene resides on chromosome 6q12. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Nufip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03035:Nufip1 APN 14 76115818 missense probably damaging 1.00
R0748:Nufip1 UTSW 14 76111068 missense probably damaging 1.00
R1576:Nufip1 UTSW 14 76134870 missense probably benign 0.00
R1641:Nufip1 UTSW 14 76126252 missense possibly damaging 0.55
R1992:Nufip1 UTSW 14 76134847 missense probably damaging 1.00
R5093:Nufip1 UTSW 14 76110973 missense probably benign 0.12
R5191:Nufip1 UTSW 14 76111989 missense probably damaging 1.00
R5212:Nufip1 UTSW 14 76133098 missense possibly damaging 0.72
R5282:Nufip1 UTSW 14 76114275 critical splice donor site probably null
R5635:Nufip1 UTSW 14 76126146 missense probably damaging 1.00
R5916:Nufip1 UTSW 14 76134900 makesense probably null
R5990:Nufip1 UTSW 14 76114188 missense probably damaging 0.99
R6328:Nufip1 UTSW 14 76111054 missense possibly damaging 0.62
R6333:Nufip1 UTSW 14 76111985 missense probably damaging 1.00
R6697:Nufip1 UTSW 14 76133073 missense probably benign 0.09
R7129:Nufip1 UTSW 14 76134885 missense possibly damaging 0.82
R7585:Nufip1 UTSW 14 76110987 missense probably benign 0.02
R7670:Nufip1 UTSW 14 76111974 frame shift probably null
R7848:Nufip1 UTSW 14 76114221 missense probably damaging 1.00
R7912:Nufip1 UTSW 14 76115002 missense possibly damaging 0.90
R7982:Nufip1 UTSW 14 76126239 missense probably benign
X0067:Nufip1 UTSW 14 76130861 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTTGCACTTTGGGCTC -3'
(R):5'- ACTAGGAACTGCAGCTTACCC -3'

Sequencing Primer
(F):5'- TAGGTGGCATGGCTGAACC -3'
(R):5'- ACTGCAGCTTACCCGGAGATTG -3'
Posted On2020-07-13