Mutagenetix > Incidental Mutation

Incidental Mutation 'R8202:Fer1l6'

635732

Institutional Source

Beutler Lab

Gene Symbol

Fer1l6

Ensembl Gene

ENSMUSG00000037106

Gene Name

fer-1-like 6 (C. elegans)

Synonyms

EG631797

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R8202 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58510048-58665092 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 58630637 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 1329 (F1329S)

Ref Sequence

ENSEMBL: ENSMUSP00000125718 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161028]

AlphaFold

E0CZ42

Predicted Effect

probably damaging
Transcript: ENSMUST00000161028
AA Change: F1329S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125718
Gene: ENSMUSG00000037106
AA Change: F1329S

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
C2	83	179	4.09e-12	SMART
FerI	165	235	2.06e-36	SMART
C2	243	354	5.19e-14	SMART
low complexity region	412	449	N/A	INTRINSIC
FerB	714	787	2.53e-45	SMART
C2	829	936	8.84e-8	SMART
C2	1000	1099	3.05e0	SMART
low complexity region	1189	1203	N/A	INTRINSIC
low complexity region	1256	1270	N/A	INTRINSIC
C2	1361	1460	5.78e-12	SMART
low complexity region	1518	1529	N/A	INTRINSIC
C2	1601	1731	1.01e-2	SMART
Pfam:Ferlin_C	1765	1857	2.3e-40	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.3%
20x: 97.6%

Validation Efficiency

100% (50/50)

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930474N05Rik	C	T	14: 36,095,100	R36C	probably benign	Het
B020011L13Rik	A	T	1: 117,801,144	H127L	probably damaging	Het
B4galt4	A	G	16: 38,767,912	Q306R	probably benign	Het
Bckdha	G	A	7: 25,630,313	H431Y	probably damaging	Het
Cacna1e	T	A	1: 154,398,449	M2256L	probably benign	Het
Ccar1	A	T	10: 62,771,989	F298L	possibly damaging	Het
Ceacam3	G	A	7: 17,163,028	A640T		Het
Cers3	A	G	7: 66,786,013	D240G	probably damaging	Het
Ces1d	T	C	8: 93,192,867	E99G	probably benign	Het
Dnah2	A	G	11: 69,478,823	V1609A	probably benign	Het
Fry	A	G	5: 150,431,737	Q1825R	probably damaging	Het
Guf1	C	A	5: 69,563,202	A335E	possibly damaging	Het
Heatr6	C	A	11: 83,759,408	T230K	possibly damaging	Het
Klhl11	G	A	11: 100,463,324	S557L	probably benign	Het
Map10	A	G	8: 125,670,908	N347D	possibly damaging	Het
Myh7	T	C	14: 54,990,040	I313V	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Nmral1	G	A	16: 4,714,584	T131M	probably damaging	Het
Npr1	T	A	3: 90,461,424	Y443F	probably benign	Het
Ntn4	A	G	10: 93,644,903	N163S	possibly damaging	Het
Nufip1	A	G	14: 76,111,164	I78V	probably benign	Het
Olfr1052	A	T	2: 86,298,624	E269D	probably benign	Het
Olfr645	A	G	7: 104,084,991	S30P	probably benign	Het
Olfr810	T	C	10: 129,790,649	*313W	probably null	Het
Oplah	C	T	15: 76,302,469	G670D	probably benign	Het
Pcnx	T	G	12: 81,895,047	I73S	probably benign	Het
Pigp	A	T	16: 94,364,669	N204K	probably benign	Het
Prelid2	T	A	18: 41,932,737	I78F	possibly damaging	Het
Ptprb	A	G	10: 116,353,845	Y1516C	probably damaging	Het
Rab31	T	C	17: 65,667,886	E157G	probably damaging	Het
Rars2	T	C	4: 34,656,180	Y445H	probably damaging	Het
Rnf220	T	A	4: 117,489,873	H114L	probably damaging	Het
Ryr1	A	G	7: 29,091,032	W1450R	probably benign	Het
Slamf6	A	G	1: 171,934,219	Y69C	probably benign	Het
Smc3	T	C	19: 53,628,692	I512T	possibly damaging	Het
Sspo	A	G	6: 48,457,600	T1009A	probably damaging	Het
St3gal3	T	A	4: 118,107,671		probably benign	Het
Tbc1d23	A	G	16: 57,191,554	F338L	probably damaging	Het
Tgs1	G	A	4: 3,586,097	A325T	probably benign	Het
Tmem30a	A	T	9: 79,774,212	I261K	probably damaging	Het
Trim3	A	T	7: 105,611,425	H662Q	possibly damaging	Het
Unc13c	C	T	9: 73,736,562	V1207M	probably damaging	Het
Vmn1r91	A	T	7: 20,101,824	I223F	probably damaging	Het
Vmn2r33	A	T	7: 7,554,154	C516S	possibly damaging	Het
Vps13c	T	C	9: 67,944,046	V2321A	probably damaging	Het
Zan	G	T	5: 137,389,327	T4874K	unknown	Het
Zfp677	T	C	17: 21,393,273	L43S	probably damaging	Het
Zfp709	A	G	8: 71,888,916		probably null	Het

Other mutations in Fer1l6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0009:Fer1l6	UTSW	15	58662787	missense	probably damaging	1.00
R0141:Fer1l6	UTSW	15	58558402	missense	probably damaging	1.00
R0178:Fer1l6	UTSW	15	58637914	splice site	probably null
R0304:Fer1l6	UTSW	15	58590562	missense	probably benign	0.08
R0379:Fer1l6	UTSW	15	58548338	missense	probably benign	0.05
R0457:Fer1l6	UTSW	15	58638094	critical splice donor site	probably null
R0546:Fer1l6	UTSW	15	58558408	splice site	probably null
R0602:Fer1l6	UTSW	15	58577945	missense	probably damaging	0.98
R0619:Fer1l6	UTSW	15	58662935	splice site	probably null
R0669:Fer1l6	UTSW	15	58553724	splice site	probably null
R0854:Fer1l6	UTSW	15	58559188	missense	probably benign	0.00
R0948:Fer1l6	UTSW	15	58564075	missense	probably benign	0.00
R1180:Fer1l6	UTSW	15	58602311	splice site	probably benign
R1483:Fer1l6	UTSW	15	58637970	missense	possibly damaging	0.84
R1627:Fer1l6	UTSW	15	58641879	missense	probably benign	0.41
R1635:Fer1l6	UTSW	15	58647081	missense	probably damaging	1.00
R1834:Fer1l6	UTSW	15	58557869	missense	possibly damaging	0.58
R1921:Fer1l6	UTSW	15	58625231	missense	probably damaging	1.00
R2000:Fer1l6	UTSW	15	58602311	splice site	probably benign
R2041:Fer1l6	UTSW	15	58558306	missense	probably damaging	1.00
R2144:Fer1l6	UTSW	15	58627534	missense	probably benign
R2145:Fer1l6	UTSW	15	58627534	missense	probably benign
R2981:Fer1l6	UTSW	15	58564077	missense	probably damaging	0.99
R4164:Fer1l6	UTSW	15	58559238	missense	possibly damaging	0.83
R4192:Fer1l6	UTSW	15	58647149	missense	probably damaging	1.00
R4273:Fer1l6	UTSW	15	58627522	missense	probably benign	0.41
R4573:Fer1l6	UTSW	15	58626280	critical splice donor site	probably null
R4581:Fer1l6	UTSW	15	58640226	missense	probably damaging	1.00
R4624:Fer1l6	UTSW	15	58553705	missense	probably damaging	1.00
R4755:Fer1l6	UTSW	15	58640211	missense	probably benign	0.09
R4774:Fer1l6	UTSW	15	58577949	missense	probably damaging	0.99
R4894:Fer1l6	UTSW	15	58618902	missense	probably damaging	1.00
R4896:Fer1l6	UTSW	15	58638020	missense	probably damaging	1.00
R4921:Fer1l6	UTSW	15	58600311	critical splice acceptor site	probably null
R4962:Fer1l6	UTSW	15	58571401	missense	probably benign	0.03
R5029:Fer1l6	UTSW	15	58643920	missense	probably benign	0.00
R5134:Fer1l6	UTSW	15	58640154	missense	probably damaging	1.00
R5175:Fer1l6	UTSW	15	58550277	missense	probably damaging	1.00
R5227:Fer1l6	UTSW	15	58581903	nonsense	probably null
R5561:Fer1l6	UTSW	15	58660825	missense	probably damaging	0.97
R5621:Fer1l6	UTSW	15	58558326	missense	probably damaging	1.00
R5670:Fer1l6	UTSW	15	58622482	missense	probably benign	0.00
R5745:Fer1l6	UTSW	15	58571389	missense	probably benign	0.01
R5807:Fer1l6	UTSW	15	58590550	nonsense	probably null
R5823:Fer1l6	UTSW	15	58590503	nonsense	probably null
R5892:Fer1l6	UTSW	15	58564068	missense	probably benign
R6006:Fer1l6	UTSW	15	58647044	missense	probably damaging	1.00
R6137:Fer1l6	UTSW	15	58559206	missense	probably damaging	0.97
R6195:Fer1l6	UTSW	15	58637957	missense	probably damaging	1.00
R6234:Fer1l6	UTSW	15	58560639	missense	probably damaging	1.00
R6237:Fer1l6	UTSW	15	58625177	nonsense	probably null
R6237:Fer1l6	UTSW	15	58638006	missense	probably damaging	1.00
R6271:Fer1l6	UTSW	15	58641918	missense	probably benign	0.01
R6336:Fer1l6	UTSW	15	58559232	nonsense	probably null
R6784:Fer1l6	UTSW	15	58571426	missense	possibly damaging	0.63
R6852:Fer1l6	UTSW	15	58594878	missense	probably damaging	1.00
R7030:Fer1l6	UTSW	15	58629378	missense	probably damaging	1.00
R7088:Fer1l6	UTSW	15	58564050	missense	possibly damaging	0.69
R7181:Fer1l6	UTSW	15	58575297	missense	probably benign	0.00
R7226:Fer1l6	UTSW	15	58590535	missense	probably benign	0.00
R7266:Fer1l6	UTSW	15	58627597	missense	probably benign
R7463:Fer1l6	UTSW	15	58573601	nonsense	probably null
R7464:Fer1l6	UTSW	15	58573247	splice site	probably null
R7469:Fer1l6	UTSW	15	58590570	splice site	probably null
R7483:Fer1l6	UTSW	15	58641945	missense	possibly damaging	0.83
R7491:Fer1l6	UTSW	15	58600432	missense	probably damaging	1.00
R7534:Fer1l6	UTSW	15	58638026	missense	probably damaging	1.00
R7562:Fer1l6	UTSW	15	58560482	missense	probably benign	0.00
R7580:Fer1l6	UTSW	15	58558396	missense	probably benign	0.41
R7599:Fer1l6	UTSW	15	58627589	missense	probably benign
R7607:Fer1l6	UTSW	15	58662732	nonsense	probably null
R7677:Fer1l6	UTSW	15	58602290	missense	probably benign	0.00
R8261:Fer1l6	UTSW	15	58560496	missense	possibly damaging	0.84
R8847:Fer1l6	UTSW	15	58542163	missense	possibly damaging	0.72
R9022:Fer1l6	UTSW	15	58583480	missense	probably damaging	0.99
R9030:Fer1l6	UTSW	15	58630745	missense	probably damaging	1.00
R9160:Fer1l6	UTSW	15	58643866	missense	possibly damaging	0.94
R9180:Fer1l6	UTSW	15	58622381	missense	probably benign	0.19
R9289:Fer1l6	UTSW	15	58618917	missense	probably damaging	1.00
R9559:Fer1l6	UTSW	15	58557910	missense	possibly damaging	0.88
R9562:Fer1l6	UTSW	15	58618521	missense	possibly damaging	0.70
R9682:Fer1l6	UTSW	15	58550264	missense	probably benign	0.03
R9775:Fer1l6	UTSW	15	58625249	missense	probably benign
X0021:Fer1l6	UTSW	15	58569202	nonsense	probably null
X0027:Fer1l6	UTSW	15	58629340	missense	probably damaging	1.00
X0063:Fer1l6	UTSW	15	58618574	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGCAGCTTGTATACATCACC -3'
(R):5'- TGCCTCCTAAATGCCTATGTTG -3'

Sequencing Primer
(F):5'- GCTTGTATACATCACCCAAAGATG -3'
(R):5'- TACAGCCCCTAGAACTGTGATAAG -3'

Posted On

2020-07-13