Incidental Mutation 'R8202:Oplah'
ID635733
Institutional Source Beutler Lab
Gene Symbol Oplah
Ensembl Gene ENSMUSG00000022562
Gene Name5-oxoprolinase (ATP-hydrolysing)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76296601-76328015 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 76302469 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 670 (G670D)
Ref Sequence ENSEMBL: ENSMUSP00000023222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023222] [ENSMUST00000164189] [ENSMUST00000165279] [ENSMUST00000171340] [ENSMUST00000210024]
Predicted Effect probably benign
Transcript: ENSMUST00000023222
AA Change: G670D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000023222
Gene: ENSMUSG00000022562
AA Change: G670D

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 1.5e-63 PFAM
Pfam:Hydantoinase_A 231 531 6.4e-109 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 734 1256 5.2e-225 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164189
AA Change: G670D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000131967
Gene: ENSMUSG00000022562
AA Change: G670D

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 9.8e-61 PFAM
Pfam:Hydantoinase_A 231 531 6.9e-103 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 853 2.3e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165279
SMART Domains Protein: ENSMUSP00000127955
Gene: ENSMUSG00000022562

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 53 8.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171340
AA Change: G670D

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000129100
Gene: ENSMUSG00000022562
AA Change: G670D

DomainStartEndE-ValueType
Pfam:Hydant_A_N 9 212 2.8e-60 PFAM
Pfam:Hydantoinase_A 231 531 6.6e-102 PFAM
low complexity region 629 637 N/A INTRINSIC
Pfam:Hydantoinase_B 733 1260 8.2e-190 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210024
Meta Mutation Damage Score 0.1432 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene acts as a homodimer, using ATP hydrolysis to catalyze the conversion of 5-oxo-L-proline to L-glutamate. Defects in this gene are a cause of 5-oxoprolinase deficiency (OPLAHD). [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Oplah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Oplah APN 15 76305748 missense probably damaging 1.00
IGL01132:Oplah APN 15 76300957 missense probably benign 0.28
IGL02252:Oplah APN 15 76304764 missense probably damaging 1.00
IGL02493:Oplah APN 15 76300955 nonsense probably null
R0033:Oplah UTSW 15 76297134 missense probably benign 0.03
R0418:Oplah UTSW 15 76298487 missense probably benign 0.06
R0609:Oplah UTSW 15 76302992 missense probably benign 0.00
R1374:Oplah UTSW 15 76306555 missense probably damaging 0.99
R1419:Oplah UTSW 15 76297920 missense probably benign 0.41
R1703:Oplah UTSW 15 76296667 missense probably benign 0.02
R1733:Oplah UTSW 15 76302483 nonsense probably null
R1959:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1960:Oplah UTSW 15 76297464 missense probably damaging 1.00
R1961:Oplah UTSW 15 76297464 missense probably damaging 1.00
R2290:Oplah UTSW 15 76302725 missense probably benign 0.00
R3552:Oplah UTSW 15 76302094 missense possibly damaging 0.78
R4019:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4020:Oplah UTSW 15 76297276 missense probably damaging 1.00
R4207:Oplah UTSW 15 76302710 missense probably damaging 1.00
R4512:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4514:Oplah UTSW 15 76297955 missense probably damaging 1.00
R4525:Oplah UTSW 15 76305509 missense probably damaging 1.00
R4803:Oplah UTSW 15 76302768 missense probably damaging 1.00
R5042:Oplah UTSW 15 76305709 nonsense probably null
R5259:Oplah UTSW 15 76301210 splice site probably null
R5284:Oplah UTSW 15 76306559 missense probably benign 0.00
R5503:Oplah UTSW 15 76305446 critical splice donor site probably null
R5511:Oplah UTSW 15 76305744 missense possibly damaging 0.74
R5549:Oplah UTSW 15 76298266 missense probably damaging 0.98
R5594:Oplah UTSW 15 76296637 makesense probably null
R5631:Oplah UTSW 15 76305241 missense probably benign 0.01
R5849:Oplah UTSW 15 76297347 unclassified probably benign
R6776:Oplah UTSW 15 76300853 missense possibly damaging 0.94
R7105:Oplah UTSW 15 76297687 missense probably damaging 1.00
R7146:Oplah UTSW 15 76302660 missense probably benign
R7267:Oplah UTSW 15 76305009 missense probably benign 0.00
R7403:Oplah UTSW 15 76305009 missense probably benign 0.00
R7786:Oplah UTSW 15 76309716 missense possibly damaging 0.93
R8029:Oplah UTSW 15 76305696 missense probably benign
R8054:Oplah UTSW 15 76306257 missense probably benign 0.00
X0065:Oplah UTSW 15 76305163 nonsense probably null
Z1177:Oplah UTSW 15 76298487 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TGATAGAACCTCTGTAGCCCTAGG -3'
(R):5'- TAGTGGACTTCAGCTGGAGG -3'

Sequencing Primer
(F):5'- TAGGCCAGGGGATCTGCTG -3'
(R):5'- ACTTCAGCTGGAGGAGACC -3'
Posted On2020-07-13