Incidental Mutation 'R8202:Nmral1'
ID635734
Institutional Source Beutler Lab
Gene Symbol Nmral1
Ensembl Gene ENSMUSG00000063445
Gene NameNmrA-like family domain containing 1
Synonyms1110025F24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location4710059-4719356 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 4714584 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 131 (T131M)
Ref Sequence ENSEMBL: ENSMUSP00000078132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074970] [ENSMUST00000079130] [ENSMUST00000115851] [ENSMUST00000120056]
Predicted Effect probably damaging
Transcript: ENSMUST00000074970
AA Change: T121M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074500
Gene: ENSMUSG00000063445
AA Change: T121M

DomainStartEndE-ValueType
Pfam:adh_short 5 80 2.2e-7 PFAM
Pfam:KR 6 79 1.5e-7 PFAM
Pfam:TrkA_N 7 92 4.1e-7 PFAM
Pfam:NAD_binding_10 7 191 5.9e-17 PFAM
Pfam:NmrA 7 240 1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079130
AA Change: T131M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078132
Gene: ENSMUSG00000063445
AA Change: T131M

DomainStartEndE-ValueType
Pfam:NmrA 7 250 3.9e-50 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115851
AA Change: T121M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111517
Gene: ENSMUSG00000063445
AA Change: T121M

DomainStartEndE-ValueType
Pfam:adh_short 5 80 3.9e-7 PFAM
Pfam:KR 6 79 2.4e-7 PFAM
Pfam:TrkA_N 7 93 9.2e-8 PFAM
Pfam:NAD_binding_10 7 188 8.1e-17 PFAM
Pfam:NmrA 7 240 1.5e-58 PFAM
low complexity region 242 253 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120056
AA Change: T121M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112754
Gene: ENSMUSG00000063445
AA Change: T121M

DomainStartEndE-ValueType
Pfam:adh_short 5 80 1.1e-6 PFAM
Pfam:KR 6 79 7.4e-7 PFAM
Pfam:TrkA_N 7 112 5.9e-7 PFAM
Pfam:NAD_binding_10 7 188 4.2e-16 PFAM
Pfam:NmrA 7 240 6.7e-58 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an NADPH sensor protein that preferentially binds to NADPH. The encoded protein also negatively regulates the activity of NF-kappaB in a ubiquitylation-dependent manner. It plays a key role in cellular antiviral response by negatively regulating the interferon response factor 3-mediated expression of interferon beta. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Nmral1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Nmral1 APN 16 4716376 missense probably benign 0.02
IGL00948:Nmral1 APN 16 4716406 missense probably damaging 1.00
IGL02065:Nmral1 APN 16 4716482 missense probably benign 0.43
R2061:Nmral1 UTSW 16 4716329 missense probably damaging 1.00
R2070:Nmral1 UTSW 16 4716347 missense probably damaging 1.00
R2071:Nmral1 UTSW 16 4716347 missense probably damaging 1.00
R3150:Nmral1 UTSW 16 4716469 missense probably damaging 1.00
R4369:Nmral1 UTSW 16 4714530 missense probably damaging 1.00
R4689:Nmral1 UTSW 16 4714558 missense probably damaging 1.00
R4690:Nmral1 UTSW 16 4716341 missense probably damaging 1.00
R4786:Nmral1 UTSW 16 4716424 missense probably damaging 1.00
R4948:Nmral1 UTSW 16 4716410 nonsense probably null
R5090:Nmral1 UTSW 16 4714531 missense probably damaging 1.00
R5503:Nmral1 UTSW 16 4715629 missense probably benign
R5989:Nmral1 UTSW 16 4719038 start gained probably benign
R6525:Nmral1 UTSW 16 4714432 nonsense probably null
R7313:Nmral1 UTSW 16 4713796 missense probably benign 0.00
R8257:Nmral1 UTSW 16 4716403 missense probably damaging 1.00
R8280:Nmral1 UTSW 16 4713795 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCTCCATGTGCTGAGAACTG -3'
(R):5'- ACATTATTCCTGAGCAGAGAGC -3'

Sequencing Primer
(F):5'- CCATGTGCTGAGAACTGTGTTTCAC -3'
(R):5'- CAGAGAGCTTCCTTGGGGTAGAG -3'
Posted On2020-07-13