Incidental Mutation 'R8202:B4galt4'
ID635735
Institutional Source Beutler Lab
Gene Symbol B4galt4
Ensembl Gene ENSMUSG00000022793
Gene NameUDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.240) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location38742264-38769049 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38767912 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 306 (Q306R)
Ref Sequence ENSEMBL: ENSMUSP00000023482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023482] [ENSMUST00000114708] [ENSMUST00000114710] [ENSMUST00000114711] [ENSMUST00000114712] [ENSMUST00000154902]
Predicted Effect probably benign
Transcript: ENSMUST00000023482
AA Change: Q306R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023482
Gene: ENSMUSG00000022793
AA Change: Q306R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 209 8.4e-63 PFAM
Pfam:Glyco_transf_7C 213 290 1e-30 PFAM
Pfam:Glyco_tranf_2_2 224 289 2.8e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114708
AA Change: Q35R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110356
Gene: ENSMUSG00000022793
AA Change: Q35R

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114710
AA Change: Q35R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110358
Gene: ENSMUSG00000022793
AA Change: Q35R

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114711
AA Change: Q35R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110359
Gene: ENSMUSG00000022793
AA Change: Q35R

DomainStartEndE-ValueType
SCOP:d1j8wb_ 1 71 2e-30 SMART
PDB:2FYD|D 1 73 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000114712
AA Change: Q306R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000110360
Gene: ENSMUSG00000022793
AA Change: Q306R

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 6.2e-58 PFAM
Pfam:Glyco_transf_7C 213 290 6.9e-31 PFAM
Pfam:Glyco_tranf_2_2 224 289 3.1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154902
SMART Domains Protein: ENSMUSP00000118593
Gene: ENSMUSG00000022793

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:Glyco_transf_7N 77 211 5.9e-59 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene appears to mainly play a role in glycolipid biosynthesis. Two alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in B4galt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01356:B4galt4 APN 16 38754144 missense probably damaging 1.00
IGL01414:B4galt4 APN 16 38757791 missense probably damaging 1.00
R0831:B4galt4 UTSW 16 38767979 missense probably benign 0.01
R2125:B4galt4 UTSW 16 38765938 missense probably damaging 0.99
R3950:B4galt4 UTSW 16 38768022 missense probably benign
R4334:B4galt4 UTSW 16 38752259 missense probably damaging 0.99
R4773:B4galt4 UTSW 16 38752296 missense probably benign 0.37
R6499:B4galt4 UTSW 16 38757822 missense probably benign 0.00
R6706:B4galt4 UTSW 16 38757811 missense probably benign 0.06
R7208:B4galt4 UTSW 16 38753940 missense probably damaging 1.00
R7500:B4galt4 UTSW 16 38768014 missense probably damaging 1.00
R7548:B4galt4 UTSW 16 38754066 missense probably damaging 1.00
R7792:B4galt4 UTSW 16 38757810 nonsense probably null
R8058:B4galt4 UTSW 16 38766021 critical splice donor site probably null
R8900:B4galt4 UTSW 16 38752042 utr 5 prime probably benign
Predicted Primers PCR Primer
(F):5'- ATCCACAAATACCTGGCTGTC -3'
(R):5'- AGTTCTTAACGTTGTGCTACTATGG -3'

Sequencing Primer
(F):5'- CCACAAATACCTGGCTGTCATTATTG -3'
(R):5'- GCTACTATGGAAGTCTCTAGGCC -3'
Posted On2020-07-13