Incidental Mutation 'R8202:Rab31'
ID635739
Institutional Source Beutler Lab
Gene Symbol Rab31
Ensembl Gene ENSMUSG00000056515
Gene NameRAB31, member RAS oncogene family
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location65651726-65772752 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65667886 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 157 (E157G)
Ref Sequence ENSEMBL: ENSMUSP00000068195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070673]
Predicted Effect probably damaging
Transcript: ENSMUST00000070673
AA Change: E157G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068195
Gene: ENSMUSG00000056515
AA Change: E157G

DomainStartEndE-ValueType
RAB 7 170 9.87e-69 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Small GTP-binding proteins of the RAB family, such as RAB31, play essential roles in vesicle and granule targeting (Bao et al., 2002 [PubMed 11784320]).[supplied by OMIM, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Smc3 T C 19: 53,628,692 I512T possibly damaging Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Rab31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02445:Rab31 APN 17 65722003 splice site probably null
IGL02493:Rab31 APN 17 65717552 missense possibly damaging 0.83
IGL03395:Rab31 APN 17 65696367 missense probably benign 0.02
R1967:Rab31 UTSW 17 65772504 critical splice donor site probably null
R4343:Rab31 UTSW 17 65654419 missense probably benign 0.00
R4810:Rab31 UTSW 17 65722003 splice site probably null
R7090:Rab31 UTSW 17 65698017 missense possibly damaging 0.92
R7228:Rab31 UTSW 17 65717553 missense probably benign 0.00
R8056:Rab31 UTSW 17 65717508 missense probably benign 0.33
R8330:Rab31 UTSW 17 65696274 missense possibly damaging 0.94
R8708:Rab31 UTSW 17 65667864 critical splice donor site probably benign
R8796:Rab31 UTSW 17 65772534 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGCACAGAATTAGGGACACT -3'
(R):5'- TGCTGCATGTTTGGCCTCC -3'

Sequencing Primer
(F):5'- TTATCATCCTGGAAAAGATGGGAAAC -3'
(R):5'- CCTGAGTTTTCATGTTTCACAAACG -3'
Posted On2020-07-13