Incidental Mutation 'R8202:Smc3'
ID635741
Institutional Source Beutler Lab
Gene Symbol Smc3
Ensembl Gene ENSMUSG00000024974
Gene Namestructural maintenance of chromosomes 3
SynonymsSmcD, Mmip1, Bamacan, Cspg6
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8202 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location53600398-53645833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53628692 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 512 (I512T)
Ref Sequence ENSEMBL: ENSMUSP00000025930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025930]
PDB Structure SMC hinge heterodimer (Mouse) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025930
AA Change: I512T

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000025930
Gene: ENSMUSG00000024974
AA Change: I512T

DomainStartEndE-ValueType
Pfam:AAA_23 5 359 5.4e-10 PFAM
SMC_hinge 530 643 1.85e-23 SMART
low complexity region 684 711 N/A INTRINSIC
Blast:SMC_hinge 712 804 3e-49 BLAST
low complexity region 805 818 N/A INTRINSIC
Blast:SMC_hinge 819 870 3e-23 BLAST
Blast:INB 898 1174 2e-52 BLAST
PDB:1XEW|Y 1032 1212 6e-30 PDB
SCOP:d1e69a_ 1114 1193 2e-9 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the SMC3 subfamily of SMC proteins. The encoded protein occurs in certain cell types as either an intracellular, nuclear protein or a secreted protein. The nuclear form, known as structural maintenance of chromosomes 3, is a component of the multimeric cohesin complex that holds together sister chromatids during mitosis, enabling proper chromosome segregation. Post-translational modification of the encoded protein by the addition of chondroitin sulfate chains gives rise to the secreted proteoglycan bamacan, an abundant basement membrane protein. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality. Mice heterozygous for this allele exhibit partial postnatal lethality, decreased body weight, abnormal craniofacial morphology, and increased T cell number. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik C T 14: 36,095,100 R36C probably benign Het
B020011L13Rik A T 1: 117,801,144 H127L probably damaging Het
B4galt4 A G 16: 38,767,912 Q306R probably benign Het
Bckdha G A 7: 25,630,313 H431Y probably damaging Het
Cacna1e T A 1: 154,398,449 M2256L probably benign Het
Ccar1 A T 10: 62,771,989 F298L possibly damaging Het
Ceacam3 G A 7: 17,163,028 A640T Het
Cers3 A G 7: 66,786,013 D240G probably damaging Het
Ces1d T C 8: 93,192,867 E99G probably benign Het
Dnah2 A G 11: 69,478,823 V1609A probably benign Het
Fer1l6 T C 15: 58,630,637 F1329S probably damaging Het
Fry A G 5: 150,431,737 Q1825R probably damaging Het
Guf1 C A 5: 69,563,202 A335E possibly damaging Het
Heatr6 C A 11: 83,759,408 T230K possibly damaging Het
Klhl11 G A 11: 100,463,324 S557L probably benign Het
Map10 A G 8: 125,670,908 N347D possibly damaging Het
Myh7 T C 14: 54,990,040 I313V probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Nmral1 G A 16: 4,714,584 T131M probably damaging Het
Npr1 T A 3: 90,461,424 Y443F probably benign Het
Ntn4 A G 10: 93,644,903 N163S possibly damaging Het
Nufip1 A G 14: 76,111,164 I78V probably benign Het
Olfr1052 A T 2: 86,298,624 E269D probably benign Het
Olfr645 A G 7: 104,084,991 S30P probably benign Het
Olfr810 T C 10: 129,790,649 *313W probably null Het
Oplah C T 15: 76,302,469 G670D probably benign Het
Pcnx T G 12: 81,895,047 I73S probably benign Het
Pigp A T 16: 94,364,669 N204K probably benign Het
Prelid2 T A 18: 41,932,737 I78F possibly damaging Het
Ptprb A G 10: 116,353,845 Y1516C probably damaging Het
Rab31 T C 17: 65,667,886 E157G probably damaging Het
Rars2 T C 4: 34,656,180 Y445H probably damaging Het
Rnf220 T A 4: 117,489,873 H114L probably damaging Het
Ryr1 A G 7: 29,091,032 W1450R probably benign Het
Slamf6 A G 1: 171,934,219 Y69C probably benign Het
Sspo A G 6: 48,457,600 T1009A probably damaging Het
St3gal3 T A 4: 118,107,671 probably benign Het
Tbc1d23 A G 16: 57,191,554 F338L probably damaging Het
Tgs1 G A 4: 3,586,097 A325T probably benign Het
Tmem30a A T 9: 79,774,212 I261K probably damaging Het
Trim3 A T 7: 105,611,425 H662Q possibly damaging Het
Unc13c C T 9: 73,736,562 V1207M probably damaging Het
Vmn1r91 A T 7: 20,101,824 I223F probably damaging Het
Vmn2r33 A T 7: 7,554,154 C516S possibly damaging Het
Vps13c T C 9: 67,944,046 V2321A probably damaging Het
Zan G T 5: 137,389,327 T4874K unknown Het
Zfp677 T C 17: 21,393,273 L43S probably damaging Het
Zfp709 A G 8: 71,888,916 probably null Het
Other mutations in Smc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Smc3 APN 19 53629327 missense probably damaging 0.99
IGL01300:Smc3 APN 19 53641852 splice site probably benign
IGL02136:Smc3 APN 19 53635716 missense probably benign 0.02
IGL02216:Smc3 APN 19 53621844 missense probably damaging 1.00
IGL02473:Smc3 APN 19 53636448 missense probably benign 0.06
IGL02797:Smc3 APN 19 53638758 missense probably benign 0.03
IGL02959:Smc3 APN 19 53623557 missense probably benign 0.00
IGL03343:Smc3 APN 19 53613842 missense probably damaging 1.00
Bits UTSW 19 53623218 critical splice donor site probably null
Pieces UTSW 19 53629371 missense probably damaging 0.99
Smithereens UTSW 19 53641931 missense probably damaging 1.00
R0081:Smc3 UTSW 19 53601562 splice site probably benign
R0940:Smc3 UTSW 19 53640909 missense probably benign 0.10
R1248:Smc3 UTSW 19 53634078 missense probably benign 0.01
R1661:Smc3 UTSW 19 53625065 missense probably benign 0.08
R1779:Smc3 UTSW 19 53639369 missense probably benign 0.02
R2046:Smc3 UTSW 19 53639414 missense probably benign 0.00
R2073:Smc3 UTSW 19 53631533 missense probably benign 0.08
R2074:Smc3 UTSW 19 53631533 missense probably benign 0.08
R3077:Smc3 UTSW 19 53627891 missense probably benign 0.16
R4962:Smc3 UTSW 19 53631517 missense probably damaging 0.99
R5684:Smc3 UTSW 19 53640804 missense probably benign 0.00
R6020:Smc3 UTSW 19 53625163 critical splice donor site probably null
R6169:Smc3 UTSW 19 53634086 missense probably benign 0.02
R6221:Smc3 UTSW 19 53641931 missense probably damaging 1.00
R6258:Smc3 UTSW 19 53627731 splice site probably null
R6960:Smc3 UTSW 19 53629371 missense probably damaging 0.99
R7048:Smc3 UTSW 19 53629251 missense probably benign 0.01
R7148:Smc3 UTSW 19 53641895 missense possibly damaging 0.93
R7157:Smc3 UTSW 19 53641898 missense probably damaging 1.00
R7805:Smc3 UTSW 19 53640959 missense probably benign 0.26
R7968:Smc3 UTSW 19 53623218 critical splice donor site probably null
R8066:Smc3 UTSW 19 53615145 missense probably damaging 1.00
R8472:Smc3 UTSW 19 53628711 missense probably benign 0.02
R8683:Smc3 UTSW 19 53641185 missense possibly damaging 0.50
R8827:Smc3 UTSW 19 53622654 missense probably benign 0.01
X0026:Smc3 UTSW 19 53625120 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GAACCCACAGTTATGCAAAATGTAG -3'
(R):5'- GCACCTGCTTCTTTACAAGAAAG -3'

Sequencing Primer
(F):5'- CCACAGTTATGCAAAATGTAGTTACC -3'
(R):5'- GAGGGTAATGGAAGACATATTGTTC -3'
Posted On2020-07-13