Incidental Mutation 'R8203:Atrn'
ID 635753
Institutional Source Beutler Lab
Gene Symbol Atrn
Ensembl Gene ENSMUSG00000027312
Gene Name attractin
Synonyms Mgca
MMRRC Submission 067626-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8203 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130748415-130872253 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 130802469 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 537 (D537N)
Ref Sequence ENSEMBL: ENSMUSP00000028781 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028781]
AlphaFold Q9WU60
Predicted Effect probably benign
Transcript: ENSMUST00000028781
AA Change: D537N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000028781
Gene: ENSMUSG00000027312
AA Change: D537N

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
low complexity region 51 97 N/A INTRINSIC
EGF 99 129 9.85e-5 SMART
CUB 131 247 7.85e-18 SMART
EGF 248 282 1.47e1 SMART
Pfam:Kelch_1 339 382 1.1e-7 PFAM
Pfam:Kelch_5 389 434 2.5e-7 PFAM
Pfam:Kelch_6 390 439 3.3e-8 PFAM
Pfam:Kelch_1 553 606 8.4e-8 PFAM
PSI 646 693 7.41e-7 SMART
PSI 702 747 8.64e-8 SMART
PSI 754 799 2.11e-2 SMART
CLECT 787 918 6.14e-20 SMART
PSI 931 982 1.11e-5 SMART
PSI 985 1060 1.2e-6 SMART
EGF_Lam 1062 1105 1.97e-4 SMART
EGF_like 1108 1154 3.9e0 SMART
transmembrane domain 1278 1300 N/A INTRINSIC
low complexity region 1310 1322 N/A INTRINSIC
low complexity region 1373 1385 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: This gene encodes a widely expressed transmembrane glycoprotein that plays important roles in diverse physiological processes such as regulation of hair pigmentation, monocyte-T cell interaction and control of energy homeostasis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. Certain mutations in this gene are responsible for the mahogany mouse phenotype of dark brown or black coat on a normally agouti background. Mice with loss-of-function mutations in this gene exhibit black coat color, tremor, adiposity, higher basal metabolic rate, juvenile-onset hypomyelination and age-dependent spongiform neurodegeneration of the central nervous system. [provided by RefSeq, Jul 2016]
PHENOTYPE: Some mutant homozygotes exhibit decreases in phaeomelanin synthesis, body weight, and adiposity; increases in locomotion, and abnormal myelination and vacuolation of the central nervous system resulting in tremors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd2 A G 15: 91,075,369 (GRCm39) I148T probably benign Het
Agbl3 A G 6: 34,776,414 (GRCm39) T307A probably damaging Het
Ahsa1 A G 12: 87,315,042 (GRCm39) D65G probably damaging Het
Aicda T C 6: 122,538,076 (GRCm39) V78A possibly damaging Het
Arhgef5 A G 6: 43,257,579 (GRCm39) D1282G probably damaging Het
Atf7ip T C 6: 136,583,781 (GRCm39) S1271P probably damaging Het
Brd10 A T 19: 29,693,443 (GRCm39) S2017T probably benign Het
Cep170 T A 1: 176,596,877 (GRCm39) Q493H probably benign Het
Cltc A T 11: 86,594,986 (GRCm39) Y1371N possibly damaging Het
Col12a1 T C 9: 79,588,831 (GRCm39) T1095A possibly damaging Het
Cxcr5 T C 9: 44,425,451 (GRCm39) M69V probably benign Het
Cyp2c69 A T 19: 39,869,584 (GRCm39) V145E probably damaging Het
Ddx3y T C Y: 1,269,827 (GRCm39) E185G probably benign Het
Dgke G A 11: 88,941,193 (GRCm39) A330V probably benign Het
Dyrk4 A G 6: 126,871,797 (GRCm39) L157P probably damaging Het
Ermard T A 17: 15,240,548 (GRCm39) S337R possibly damaging Het
Etl4 A T 2: 20,789,916 (GRCm39) M805L possibly damaging Het
Flvcr2 GTAGTGTATA GTA 12: 85,849,922 (GRCm39) probably null Het
Fmn1 T A 2: 113,355,620 (GRCm39) M785K unknown Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,436,769 (GRCm39) probably benign Het
Gabrg3 G A 7: 56,423,008 (GRCm39) T230I possibly damaging Het
Gle1 A G 2: 29,825,522 (GRCm39) D4G probably benign Het
Gm5468 T C 15: 25,414,527 (GRCm39) S26P noncoding transcript Het
Igsf10 A T 3: 59,236,254 (GRCm39) L1309Q probably benign Het
Lipf A G 19: 33,944,283 (GRCm39) K164R probably benign Het
Luc7l C A 17: 26,485,333 (GRCm39) T111K possibly damaging Het
Masp2 A G 4: 148,696,599 (GRCm39) T399A probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Naip1 T C 13: 100,562,328 (GRCm39) I946V probably benign Het
Neb T A 2: 52,039,259 (GRCm39) K6927* probably null Het
Nipal4 A T 11: 46,041,147 (GRCm39) D349E probably damaging Het
Or12j2 A T 7: 139,915,939 (GRCm39) T55S probably benign Het
Or5al7 T A 2: 85,992,844 (GRCm39) I150F probably benign Het
Or7g22 A G 9: 19,049,170 (GRCm39) N294D probably damaging Het
Pdik1l A T 4: 134,006,676 (GRCm39) H154Q unknown Het
Polr2m T G 9: 71,386,768 (GRCm39) M338L probably benign Het
Rab3gap2 T C 1: 184,999,376 (GRCm39) L995P probably damaging Het
Rnf17 T A 14: 56,705,179 (GRCm39) H694Q probably benign Het
Sar1b A G 11: 51,670,524 (GRCm39) K23E probably benign Het
Setd7 A T 3: 51,437,519 (GRCm39) Y245* probably null Het
Shpk A C 11: 73,104,904 (GRCm39) D171A probably benign Het
Slc2a7 G T 4: 150,243,015 (GRCm39) E279* probably null Het
Slco4a1 T C 2: 180,106,592 (GRCm39) V258A probably damaging Het
Srcin1 G T 11: 97,457,539 (GRCm39) P62Q probably damaging Het
Tbc1d2 A G 4: 46,606,476 (GRCm39) F823S probably damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tdrd9 T A 12: 111,992,064 (GRCm39) V613E probably damaging Het
Tsc1 A G 2: 28,563,007 (GRCm39) probably null Het
Ulk4 A T 9: 120,997,274 (GRCm39) M766K probably damaging Het
Wdr36 G T 18: 32,985,136 (GRCm39) G481* probably null Het
Yme1l1 G A 2: 23,054,538 (GRCm39) R119H probably benign Het
Zfp106 G A 2: 120,349,559 (GRCm39) T1644I probably damaging Het
Other mutations in Atrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Atrn APN 2 130,799,999 (GRCm39) missense probably damaging 1.00
IGL00571:Atrn APN 2 130,836,968 (GRCm39) missense probably damaging 1.00
IGL01092:Atrn APN 2 130,789,556 (GRCm39) nonsense probably null
IGL01572:Atrn APN 2 130,844,715 (GRCm39) missense probably damaging 1.00
IGL01924:Atrn APN 2 130,777,485 (GRCm39) missense probably damaging 1.00
IGL02116:Atrn APN 2 130,800,009 (GRCm39) missense probably damaging 1.00
IGL02372:Atrn APN 2 130,844,674 (GRCm39) splice site probably benign
IGL02390:Atrn APN 2 130,862,897 (GRCm39) missense possibly damaging 0.82
IGL02548:Atrn APN 2 130,814,202 (GRCm39) missense probably damaging 1.00
IGL02749:Atrn APN 2 130,789,654 (GRCm39) splice site probably benign
IGL02749:Atrn APN 2 130,812,064 (GRCm39) nonsense probably null
BB010:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
BB020:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R0026:Atrn UTSW 2 130,799,840 (GRCm39) missense probably damaging 1.00
R0403:Atrn UTSW 2 130,748,779 (GRCm39) missense probably damaging 1.00
R0479:Atrn UTSW 2 130,841,085 (GRCm39) nonsense probably null
R0544:Atrn UTSW 2 130,828,746 (GRCm39) missense probably damaging 1.00
R0570:Atrn UTSW 2 130,822,054 (GRCm39) missense probably benign 0.01
R0606:Atrn UTSW 2 130,748,776 (GRCm39) missense possibly damaging 0.90
R0617:Atrn UTSW 2 130,837,005 (GRCm39) critical splice donor site probably null
R0658:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R1108:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1112:Atrn UTSW 2 130,841,081 (GRCm39) missense probably benign 0.04
R1219:Atrn UTSW 2 130,862,927 (GRCm39) missense possibly damaging 0.90
R1422:Atrn UTSW 2 130,799,834 (GRCm39) missense probably damaging 1.00
R1524:Atrn UTSW 2 130,799,000 (GRCm39) missense probably benign 0.15
R1653:Atrn UTSW 2 130,777,544 (GRCm39) missense probably benign
R1795:Atrn UTSW 2 130,814,208 (GRCm39) missense probably benign
R1807:Atrn UTSW 2 130,824,692 (GRCm39) missense possibly damaging 0.94
R1920:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1921:Atrn UTSW 2 130,836,971 (GRCm39) missense probably damaging 1.00
R1935:Atrn UTSW 2 130,799,955 (GRCm39) missense probably damaging 1.00
R1982:Atrn UTSW 2 130,812,142 (GRCm39) missense probably benign
R2000:Atrn UTSW 2 130,777,508 (GRCm39) missense probably damaging 1.00
R2143:Atrn UTSW 2 130,799,916 (GRCm39) missense probably benign 0.03
R2336:Atrn UTSW 2 130,799,874 (GRCm39) missense probably damaging 1.00
R2679:Atrn UTSW 2 130,803,595 (GRCm39) critical splice donor site probably null
R3426:Atrn UTSW 2 130,862,876 (GRCm39) missense probably benign 0.06
R3909:Atrn UTSW 2 130,836,127 (GRCm39) missense probably damaging 1.00
R4077:Atrn UTSW 2 130,806,850 (GRCm39) critical splice donor site probably null
R4162:Atrn UTSW 2 130,836,148 (GRCm39) splice site probably benign
R4195:Atrn UTSW 2 130,775,332 (GRCm39) missense probably damaging 1.00
R4364:Atrn UTSW 2 130,812,128 (GRCm39) missense probably benign 0.39
R4465:Atrn UTSW 2 130,802,388 (GRCm39) missense probably benign 0.08
R4510:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4511:Atrn UTSW 2 130,777,497 (GRCm39) nonsense probably null
R4527:Atrn UTSW 2 130,815,424 (GRCm39) missense probably benign 0.10
R4586:Atrn UTSW 2 130,823,962 (GRCm39) missense probably damaging 1.00
R4592:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R4658:Atrn UTSW 2 130,775,349 (GRCm39) missense probably damaging 1.00
R4735:Atrn UTSW 2 130,862,910 (GRCm39) missense probably benign 0.06
R4960:Atrn UTSW 2 130,836,967 (GRCm39) nonsense probably null
R4999:Atrn UTSW 2 130,817,874 (GRCm39) missense probably damaging 1.00
R5066:Atrn UTSW 2 130,836,113 (GRCm39) missense possibly damaging 0.60
R5080:Atrn UTSW 2 130,812,044 (GRCm39) missense possibly damaging 0.95
R5141:Atrn UTSW 2 130,841,050 (GRCm39) intron probably benign
R5256:Atrn UTSW 2 130,787,939 (GRCm39) missense probably benign 0.39
R5494:Atrn UTSW 2 130,864,995 (GRCm39) missense probably damaging 1.00
R5678:Atrn UTSW 2 130,811,936 (GRCm39) missense probably damaging 0.96
R5752:Atrn UTSW 2 130,748,464 (GRCm39) unclassified probably benign
R5931:Atrn UTSW 2 130,775,356 (GRCm39) missense possibly damaging 0.56
R6023:Atrn UTSW 2 130,862,900 (GRCm39) missense probably benign 0.25
R6176:Atrn UTSW 2 130,788,011 (GRCm39) missense probably benign 0.31
R6377:Atrn UTSW 2 130,821,889 (GRCm39) missense probably damaging 1.00
R6433:Atrn UTSW 2 130,864,947 (GRCm39) missense probably damaging 1.00
R7226:Atrn UTSW 2 130,828,664 (GRCm39) missense probably damaging 0.99
R7402:Atrn UTSW 2 130,789,520 (GRCm39) missense probably damaging 1.00
R7541:Atrn UTSW 2 130,803,491 (GRCm39) missense possibly damaging 0.46
R7587:Atrn UTSW 2 130,822,034 (GRCm39) missense probably damaging 1.00
R7872:Atrn UTSW 2 130,812,147 (GRCm39) critical splice donor site probably null
R7910:Atrn UTSW 2 130,806,807 (GRCm39) missense probably benign 0.04
R7913:Atrn UTSW 2 130,812,131 (GRCm39) missense probably damaging 1.00
R7933:Atrn UTSW 2 130,836,986 (GRCm39) missense probably damaging 1.00
R8044:Atrn UTSW 2 130,777,449 (GRCm39) missense probably damaging 1.00
R8079:Atrn UTSW 2 130,855,561 (GRCm39) missense probably null 1.00
R8093:Atrn UTSW 2 130,817,908 (GRCm39) missense probably benign 0.00
R8234:Atrn UTSW 2 130,864,920 (GRCm39) critical splice acceptor site probably null
R8462:Atrn UTSW 2 130,777,504 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,846,494 (GRCm39) missense probably damaging 1.00
R8816:Atrn UTSW 2 130,748,798 (GRCm39) missense probably damaging 1.00
R8831:Atrn UTSW 2 130,748,521 (GRCm39) missense probably benign 0.22
R8937:Atrn UTSW 2 130,841,157 (GRCm39) missense probably benign 0.00
R9161:Atrn UTSW 2 130,777,470 (GRCm39) missense probably damaging 1.00
R9722:Atrn UTSW 2 130,803,536 (GRCm39) missense probably damaging 1.00
R9786:Atrn UTSW 2 130,786,809 (GRCm39) missense probably damaging 1.00
RF009:Atrn UTSW 2 130,748,842 (GRCm39) missense probably benign 0.12
X0024:Atrn UTSW 2 130,800,059 (GRCm39) missense probably damaging 1.00
Z1088:Atrn UTSW 2 130,815,319 (GRCm39) missense probably benign
Z1176:Atrn UTSW 2 130,788,113 (GRCm39) missense probably benign 0.27
Z1177:Atrn UTSW 2 130,787,962 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGAGCCTGCAACATTGAC -3'
(R):5'- GTTCAGTGAATCAGGTCTAAAGC -3'

Sequencing Primer
(F):5'- GAGGAGCCTGCAACATTGACTTTAAC -3'
(R):5'- TGAATCAGGTCTAAAGCACTAAGC -3'
Posted On 2020-07-13