Incidental Mutation 'R8203:Slco4a1'
ID 635754
Institutional Source Beutler Lab
Gene Symbol Slco4a1
Ensembl Gene ENSMUSG00000038963
Gene Name solute carrier organic anion transporter family, member 4a1
Synonyms Slc21a12, OATP-E
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock # R8203 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 180456245-180474867 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 180464799 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 258 (V258A)
Ref Sequence ENSEMBL: ENSMUSP00000045023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038225] [ENSMUST00000038259]
AlphaFold Q8K078
Predicted Effect probably damaging
Transcript: ENSMUST00000038225
AA Change: V258A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000045023
Gene: ENSMUSG00000038963
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 103 665 5.7e-168 PFAM
Pfam:MFS_1 105 496 3e-15 PFAM
Pfam:Kazal_2 512 555 1.1e-7 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000038259
AA Change: V258A

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046502
Gene: ENSMUSG00000038963
AA Change: V258A

DomainStartEndE-ValueType
low complexity region 33 46 N/A INTRINSIC
Pfam:OATP 101 666 2.8e-172 PFAM
Pfam:MFS_1 105 496 2.5e-15 PFAM
Pfam:Kazal_2 512 555 7.7e-8 PFAM
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 701 718 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,043 S2017T probably benign Het
Abcd2 A G 15: 91,191,166 I148T probably benign Het
Agbl3 A G 6: 34,799,479 T307A probably damaging Het
Ahsa1 A G 12: 87,268,268 D65G probably damaging Het
Aicda T C 6: 122,561,117 V78A possibly damaging Het
Arhgef5 A G 6: 43,280,645 D1282G probably damaging Het
Atf7ip T C 6: 136,606,783 S1271P probably damaging Het
Atrn G A 2: 130,960,549 D537N probably benign Het
Cep170 T A 1: 176,769,311 Q493H probably benign Het
Cltc A T 11: 86,704,160 Y1371N possibly damaging Het
Col12a1 T C 9: 79,681,549 T1095A possibly damaging Het
Cxcr5 T C 9: 44,514,154 M69V probably benign Het
Cyp2c69 A T 19: 39,881,140 V145E probably damaging Het
Ddx3y T C Y: 1,269,827 E185G probably benign Het
Dgke G A 11: 89,050,367 A330V probably benign Het
Dyrk4 A G 6: 126,894,834 L157P probably damaging Het
Ermard T A 17: 15,020,286 S337R possibly damaging Het
Etl4 A T 2: 20,785,105 M805L possibly damaging Het
Fmn1 T A 2: 113,525,275 M785K unknown Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabrg3 G A 7: 56,773,260 T230I possibly damaging Het
Gle1 A G 2: 29,935,510 D4G probably benign Het
Gm5468 T C 15: 25,414,441 S26P noncoding transcript Het
Igsf10 A T 3: 59,328,833 L1309Q probably benign Het
Lipf A G 19: 33,966,883 K164R probably benign Het
Luc7l C A 17: 26,266,359 T111K possibly damaging Het
Masp2 A G 4: 148,612,142 T399A probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip1 T C 13: 100,425,820 I946V probably benign Het
Neb T A 2: 52,149,247 K6927* probably null Het
Nipal4 A T 11: 46,150,320 D349E probably damaging Het
Olfr1043 T A 2: 86,162,500 I150F probably benign Het
Olfr527 A T 7: 140,336,026 T55S probably benign Het
Olfr837 A G 9: 19,137,874 N294D probably damaging Het
Pdik1l A T 4: 134,279,365 H154Q unknown Het
Polr2m T G 9: 71,479,486 M338L probably benign Het
Rab3gap2 T C 1: 185,267,179 L995P probably damaging Het
Rnf17 T A 14: 56,467,722 H694Q probably benign Het
Sar1b A G 11: 51,779,697 K23E probably benign Het
Setd7 A T 3: 51,530,098 Y245* probably null Het
Shpk A C 11: 73,214,078 D171A probably benign Het
Slc2a7 G T 4: 150,158,558 E279* probably null Het
Srcin1 G T 11: 97,566,713 P62Q probably damaging Het
Tbc1d2 A G 4: 46,606,476 F823S probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd9 T A 12: 112,025,630 V613E probably damaging Het
Tsc1 A G 2: 28,672,995 probably null Het
Ulk4 A T 9: 121,168,208 M766K probably damaging Het
Wdr36 G T 18: 32,852,083 G481* probably null Het
Yme1l1 G A 2: 23,164,526 R119H probably benign Het
Zfp106 G A 2: 120,519,078 T1644I probably damaging Het
Other mutations in Slco4a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01745:Slco4a1 APN 2 180464679 missense probably damaging 1.00
IGL01982:Slco4a1 APN 2 180473153 missense probably benign 0.03
IGL02297:Slco4a1 APN 2 180464489 missense probably benign 0.16
IGL02368:Slco4a1 APN 2 180473128 missense probably damaging 0.98
conduit UTSW 2 180473615 missense probably damaging 1.00
ingress UTSW 2 180465677 missense probably benign
R1621:Slco4a1 UTSW 2 180471132 missense probably benign 0.01
R2275:Slco4a1 UTSW 2 180464736 missense possibly damaging 0.94
R2472:Slco4a1 UTSW 2 180467087 missense probably damaging 1.00
R3851:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R3852:Slco4a1 UTSW 2 180464091 missense probably benign 0.00
R4271:Slco4a1 UTSW 2 180474210 missense possibly damaging 0.85
R4439:Slco4a1 UTSW 2 180472662 missense probably benign 0.02
R4571:Slco4a1 UTSW 2 180464378 missense probably benign 0.32
R4732:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4733:Slco4a1 UTSW 2 180473615 missense probably damaging 1.00
R4925:Slco4a1 UTSW 2 180472056 missense probably benign 0.35
R5156:Slco4a1 UTSW 2 180472779 missense probably benign 0.01
R5186:Slco4a1 UTSW 2 180473108 missense probably damaging 1.00
R5252:Slco4a1 UTSW 2 180464459 missense possibly damaging 0.48
R5426:Slco4a1 UTSW 2 180471235 missense possibly damaging 0.84
R5470:Slco4a1 UTSW 2 180474114 missense probably benign 0.00
R5512:Slco4a1 UTSW 2 180474114 missense possibly damaging 0.91
R6969:Slco4a1 UTSW 2 180464808 missense probably benign
R7133:Slco4a1 UTSW 2 180472063 missense possibly damaging 0.93
R7249:Slco4a1 UTSW 2 180464811 missense probably benign 0.01
R7357:Slco4a1 UTSW 2 180472137 missense probably benign 0.00
R7442:Slco4a1 UTSW 2 180474126 missense probably benign
R7599:Slco4a1 UTSW 2 180471255 missense probably benign
R7750:Slco4a1 UTSW 2 180471237 missense probably benign 0.30
R7834:Slco4a1 UTSW 2 180465677 missense probably benign
R8504:Slco4a1 UTSW 2 180464799 missense probably damaging 0.96
R9166:Slco4a1 UTSW 2 180464241 missense probably benign 0.00
R9170:Slco4a1 UTSW 2 180464685 missense probably benign 0.00
R9210:Slco4a1 UTSW 2 180472478 missense probably damaging 1.00
Z1177:Slco4a1 UTSW 2 180464381 missense possibly damaging 0.85
Z1177:Slco4a1 UTSW 2 180464564 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTCCCTGGTATTTGCACTG -3'
(R):5'- GCTTAGGGACACTTGGATCATATG -3'

Sequencing Primer
(F):5'- CGGCCGCTATGAGGTAGAG -3'
(R):5'- CACTTGGATCATATGGCCGAG -3'
Posted On 2020-07-13