Mutagenetix > Incidental Mutation

Incidental Mutation 'R8203:Agbl3'

635762

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8203 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34799479 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 307 (T307A)

Ref Sequence

ENSEMBL: ENSMUSP00000110668 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: T307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: T307A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: T302A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: T302A

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

98% (53/54)

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930021J03Rik	A	T	19: 29,716,043	S2017T	probably benign	Het
Abcd2	A	G	15: 91,191,166	I148T	probably benign	Het
Ahsa1	A	G	12: 87,268,268	D65G	probably damaging	Het
Aicda	T	C	6: 122,561,117	V78A	possibly damaging	Het
Arhgef5	A	G	6: 43,280,645	D1282G	probably damaging	Het
Atf7ip	T	C	6: 136,606,783	S1271P	probably damaging	Het
Atrn	G	A	2: 130,960,549	D537N	probably benign	Het
Cep170	T	A	1: 176,769,311	Q493H	probably benign	Het
Cltc	A	T	11: 86,704,160	Y1371N	possibly damaging	Het
Col12a1	T	C	9: 79,681,549	T1095A	possibly damaging	Het
Cxcr5	T	C	9: 44,514,154	M69V	probably benign	Het
Cyp2c69	A	T	19: 39,881,140	V145E	probably damaging	Het
Ddx3y	T	C	Y: 1,269,827	E185G	probably benign	Het
Dgke	G	A	11: 89,050,367	A330V	probably benign	Het
Dyrk4	A	G	6: 126,894,834	L157P	probably damaging	Het
Ermard	T	A	17: 15,020,286	S337R	possibly damaging	Het
Etl4	A	T	2: 20,785,105	M805L	possibly damaging	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fmn1	T	A	2: 113,525,275	M785K	unknown	Het
Fmn2	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC	1: 174,609,203		probably benign	Het
Gabrg3	G	A	7: 56,773,260	T230I	possibly damaging	Het
Gle1	A	G	2: 29,935,510	D4G	probably benign	Het
Gm5468	T	C	15: 25,414,441	S26P	noncoding transcript	Het
Igsf10	A	T	3: 59,328,833	L1309Q	probably benign	Het
Lipf	A	G	19: 33,966,883	K164R	probably benign	Het
Luc7l	C	A	17: 26,266,359	T111K	possibly damaging	Het
Masp2	A	G	4: 148,612,142	T399A	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip1	T	C	13: 100,425,820	I946V	probably benign	Het
Neb	T	A	2: 52,149,247	K6927*	probably null	Het
Nipal4	A	T	11: 46,150,320	D349E	probably damaging	Het
Olfr1043	T	A	2: 86,162,500	I150F	probably benign	Het
Olfr527	A	T	7: 140,336,026	T55S	probably benign	Het
Olfr837	A	G	9: 19,137,874	N294D	probably damaging	Het
Pdik1l	A	T	4: 134,279,365	H154Q	unknown	Het
Polr2m	T	G	9: 71,479,486	M338L	probably benign	Het
Rab3gap2	T	C	1: 185,267,179	L995P	probably damaging	Het
Rnf17	T	A	14: 56,467,722	H694Q	probably benign	Het
Sar1b	A	G	11: 51,779,697	K23E	probably benign	Het
Setd7	A	T	3: 51,530,098	Y245*	probably null	Het
Shpk	A	C	11: 73,214,078	D171A	probably benign	Het
Slc2a7	G	T	4: 150,158,558	E279*	probably null	Het
Slco4a1	T	C	2: 180,464,799	V258A	probably damaging	Het
Srcin1	G	T	11: 97,566,713	P62Q	probably damaging	Het
Tbc1d2	A	G	4: 46,606,476	F823S	probably damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tdrd9	T	A	12: 112,025,630	V613E	probably damaging	Het
Tsc1	A	G	2: 28,672,995		probably null	Het
Ulk4	A	T	9: 121,168,208	M766K	probably damaging	Het
Wdr36	G	T	18: 32,852,083	G481*	probably null	Het
Yme1l1	G	A	2: 23,164,526	R119H	probably benign	Het
Zfp106	G	A	2: 120,519,078	T1644I	probably damaging	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6018:Agbl3	UTSW	6	34799255	missense	probably damaging	1.00
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTTTACCAAGCCTGCTAGTC -3'
(R):5'- GCAGTCAAAATCACAGCCTTGC -3'

Sequencing Primer
(F):5'- AAGCCTGCTAGTCTTTACAATCGGG -3'
(R):5'- CGCTTTGAGTCACTAGTCTTCAAGG -3'

Posted On

2020-07-13