Incidental Mutation 'R8203:Arhgef5'
ID 635763
Institutional Source Beutler Lab
Gene Symbol Arhgef5
Ensembl Gene ENSMUSG00000033542
Gene Name Rho guanine nucleotide exchange factor (GEF) 5
Synonyms 2210412D05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8203 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 43265582-43289320 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 43280645 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 1282 (D1282G)
Ref Sequence ENSEMBL: ENSMUSP00000031750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031750]
AlphaFold E9Q7D5
Predicted Effect probably damaging
Transcript: ENSMUST00000031750
AA Change: D1282G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: D1282G

DomainStartEndE-ValueType
Pfam:ARHGEF5_35 1 477 3.1e-220 PFAM
low complexity region 509 531 N/A INTRINSIC
low complexity region 812 825 N/A INTRINSIC
low complexity region 827 851 N/A INTRINSIC
RhoGEF 1162 1341 2.97e-57 SMART
PH 1375 1488 1.11e-6 SMART
SH3 1497 1554 6.39e-15 SMART
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,043 S2017T probably benign Het
Abcd2 A G 15: 91,191,166 I148T probably benign Het
Agbl3 A G 6: 34,799,479 T307A probably damaging Het
Ahsa1 A G 12: 87,268,268 D65G probably damaging Het
Aicda T C 6: 122,561,117 V78A possibly damaging Het
Atf7ip T C 6: 136,606,783 S1271P probably damaging Het
Atrn G A 2: 130,960,549 D537N probably benign Het
Cep170 T A 1: 176,769,311 Q493H probably benign Het
Cltc A T 11: 86,704,160 Y1371N possibly damaging Het
Col12a1 T C 9: 79,681,549 T1095A possibly damaging Het
Cxcr5 T C 9: 44,514,154 M69V probably benign Het
Cyp2c69 A T 19: 39,881,140 V145E probably damaging Het
Ddx3y T C Y: 1,269,827 E185G probably benign Het
Dgke G A 11: 89,050,367 A330V probably benign Het
Dyrk4 A G 6: 126,894,834 L157P probably damaging Het
Ermard T A 17: 15,020,286 S337R possibly damaging Het
Etl4 A T 2: 20,785,105 M805L possibly damaging Het
Fmn1 T A 2: 113,525,275 M785K unknown Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabrg3 G A 7: 56,773,260 T230I possibly damaging Het
Gle1 A G 2: 29,935,510 D4G probably benign Het
Gm5468 T C 15: 25,414,441 S26P noncoding transcript Het
Igsf10 A T 3: 59,328,833 L1309Q probably benign Het
Lipf A G 19: 33,966,883 K164R probably benign Het
Luc7l C A 17: 26,266,359 T111K possibly damaging Het
Masp2 A G 4: 148,612,142 T399A probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip1 T C 13: 100,425,820 I946V probably benign Het
Neb T A 2: 52,149,247 K6927* probably null Het
Nipal4 A T 11: 46,150,320 D349E probably damaging Het
Olfr1043 T A 2: 86,162,500 I150F probably benign Het
Olfr527 A T 7: 140,336,026 T55S probably benign Het
Olfr837 A G 9: 19,137,874 N294D probably damaging Het
Pdik1l A T 4: 134,279,365 H154Q unknown Het
Polr2m T G 9: 71,479,486 M338L probably benign Het
Rab3gap2 T C 1: 185,267,179 L995P probably damaging Het
Rnf17 T A 14: 56,467,722 H694Q probably benign Het
Sar1b A G 11: 51,779,697 K23E probably benign Het
Setd7 A T 3: 51,530,098 Y245* probably null Het
Shpk A C 11: 73,214,078 D171A probably benign Het
Slc2a7 G T 4: 150,158,558 E279* probably null Het
Slco4a1 T C 2: 180,464,799 V258A probably damaging Het
Srcin1 G T 11: 97,566,713 P62Q probably damaging Het
Tbc1d2 A G 4: 46,606,476 F823S probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd9 T A 12: 112,025,630 V613E probably damaging Het
Tsc1 A G 2: 28,672,995 probably null Het
Ulk4 A T 9: 121,168,208 M766K probably damaging Het
Wdr36 G T 18: 32,852,083 G481* probably null Het
Yme1l1 G A 2: 23,164,526 R119H probably benign Het
Zfp106 G A 2: 120,519,078 T1644I probably damaging Het
Other mutations in Arhgef5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Arhgef5 APN 6 43280269 nonsense probably null
IGL01341:Arhgef5 APN 6 43283991 missense probably damaging 1.00
IGL01576:Arhgef5 APN 6 43274028 missense probably benign 0.38
IGL01761:Arhgef5 APN 6 43274604 missense probably benign 0.00
IGL02104:Arhgef5 APN 6 43272411 missense probably damaging 0.99
IGL02208:Arhgef5 APN 6 43275130 missense probably benign 0.11
IGL02487:Arhgef5 APN 6 43283982 missense probably damaging 1.00
IGL02650:Arhgef5 APN 6 43272935 nonsense probably null
IGL03292:Arhgef5 APN 6 43280246 missense probably damaging 1.00
IGL03334:Arhgef5 APN 6 43274000 missense possibly damaging 0.47
IGL03341:Arhgef5 APN 6 43280651 missense probably damaging 0.99
R0047:Arhgef5 UTSW 6 43265621 splice site probably null
R0206:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0208:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R0698:Arhgef5 UTSW 6 43273341 missense probably damaging 1.00
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1145:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R1168:Arhgef5 UTSW 6 43273396 missense probably benign 0.00
R1355:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1370:Arhgef5 UTSW 6 43283912 missense probably damaging 1.00
R1481:Arhgef5 UTSW 6 43274634 missense probably damaging 0.99
R1529:Arhgef5 UTSW 6 43279515 missense probably damaging 0.96
R1532:Arhgef5 UTSW 6 43273403 missense probably benign
R1663:Arhgef5 UTSW 6 43276965 missense probably damaging 1.00
R1742:Arhgef5 UTSW 6 43280199 missense probably damaging 1.00
R1852:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R1869:Arhgef5 UTSW 6 43288682 missense probably damaging 1.00
R1880:Arhgef5 UTSW 6 43273088 missense possibly damaging 0.92
R2146:Arhgef5 UTSW 6 43283318 missense probably damaging 1.00
R2169:Arhgef5 UTSW 6 43274420 missense probably benign 0.11
R3412:Arhgef5 UTSW 6 43273790 missense probably benign
R4205:Arhgef5 UTSW 6 43273832 missense possibly damaging 0.76
R4226:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4227:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4304:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4308:Arhgef5 UTSW 6 43279498 missense probably damaging 1.00
R4457:Arhgef5 UTSW 6 43274093 missense probably damaging 1.00
R4469:Arhgef5 UTSW 6 43275099 missense probably benign
R4636:Arhgef5 UTSW 6 43274942 missense probably benign 0.11
R4791:Arhgef5 UTSW 6 43283183 missense probably damaging 1.00
R4818:Arhgef5 UTSW 6 43273550 missense probably benign 0.00
R4910:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R4911:Arhgef5 UTSW 6 43272828 missense probably benign 0.01
R5127:Arhgef5 UTSW 6 43273214 missense probably damaging 0.99
R5209:Arhgef5 UTSW 6 43273700 missense probably benign 0.01
R5245:Arhgef5 UTSW 6 43265680 start gained probably benign
R5251:Arhgef5 UTSW 6 43272881 missense possibly damaging 0.76
R5513:Arhgef5 UTSW 6 43272339 missense probably damaging 0.96
R5613:Arhgef5 UTSW 6 43274063 missense probably benign 0.01
R5616:Arhgef5 UTSW 6 43275940 missense probably benign 0.20
R5817:Arhgef5 UTSW 6 43275104 missense probably benign 0.15
R6024:Arhgef5 UTSW 6 43275134 missense probably benign 0.00
R6735:Arhgef5 UTSW 6 43275032 missense probably benign 0.01
R6825:Arhgef5 UTSW 6 43274961 missense probably damaging 0.99
R6831:Arhgef5 UTSW 6 43280999 missense probably damaging 1.00
R6901:Arhgef5 UTSW 6 43273298 missense probably benign 0.00
R6932:Arhgef5 UTSW 6 43274417 missense possibly damaging 0.94
R6968:Arhgef5 UTSW 6 43275342 missense probably benign 0.00
R7018:Arhgef5 UTSW 6 43288731 missense probably damaging 1.00
R7180:Arhgef5 UTSW 6 43275208 missense possibly damaging 0.87
R7201:Arhgef5 UTSW 6 43273232 nonsense probably null
R7358:Arhgef5 UTSW 6 43279573 missense probably damaging 1.00
R7359:Arhgef5 UTSW 6 43280282 missense probably damaging 1.00
R7468:Arhgef5 UTSW 6 43280671 nonsense probably null
R7503:Arhgef5 UTSW 6 43273999 missense probably benign 0.15
R7699:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7700:Arhgef5 UTSW 6 43274757 missense probably benign 0.11
R7737:Arhgef5 UTSW 6 43273794 missense possibly damaging 0.84
R7847:Arhgef5 UTSW 6 43275135 nonsense probably null
R7950:Arhgef5 UTSW 6 43273925 missense possibly damaging 0.76
R8161:Arhgef5 UTSW 6 43283951 missense probably damaging 1.00
R8178:Arhgef5 UTSW 6 43275185 missense probably benign 0.00
R8318:Arhgef5 UTSW 6 43275999 critical splice donor site probably null
R8857:Arhgef5 UTSW 6 43287624 missense probably damaging 1.00
R9499:Arhgef5 UTSW 6 43284006 missense
R9610:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9611:Arhgef5 UTSW 6 43280956 missense probably damaging 0.99
R9623:Arhgef5 UTSW 6 43274802 missense possibly damaging 0.86
R9685:Arhgef5 UTSW 6 43273593 missense probably benign 0.11
RF023:Arhgef5 UTSW 6 43279473 missense probably damaging 1.00
X0028:Arhgef5 UTSW 6 43273701 missense probably benign 0.03
X0065:Arhgef5 UTSW 6 43272408 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GAAGTTTCAGCCCATTGCCC -3'
(R):5'- CATGATGTGGAAACTTCACAAATGG -3'

Sequencing Primer
(F):5'- AGTCATATCTGGACCCTGTACATGG -3'
(R):5'- AAATGGATGACACTTTGCCTCC -3'
Posted On 2020-07-13