Incidental Mutation 'R0722:Htr1f'
ID63577
Institutional Source Beutler Lab
Gene Symbol Htr1f
Ensembl Gene ENSMUSG00000050783
Gene Name5-hydroxytryptamine (serotonin) receptor 1F
SynonymsHtr1eb
MMRRC Submission 038904-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0722 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location64924729-65105854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 64925891 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 346 (I346T)
Ref Sequence ENSEMBL: ENSMUSP00000063136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063076]
Predicted Effect probably damaging
Transcript: ENSMUST00000063076
AA Change: I346T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000063136
Gene: ENSMUSG00000050783
AA Change: I346T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 32 230 4.8e-7 PFAM
Pfam:7TM_GPCR_Srsx 34 362 2.4e-10 PFAM
Pfam:7tm_1 40 347 4.1e-74 PFAM
Pfam:7TM_GPCR_Srv 54 249 5.2e-7 PFAM
Meta Mutation Damage Score 0.5901 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display decreased temperature sensitivity and physiological abnormalities in nerve fibers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,156,984 F89L possibly damaging Het
Akr1c13 A G 13: 4,197,932 probably null Het
Atp10a A G 7: 58,816,183 I1053V possibly damaging Het
Bmper G T 9: 23,373,928 V258L probably benign Het
Brd4 T C 17: 32,212,982 H636R possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Ccbe1 C T 18: 66,084,806 C112Y probably damaging Het
Ccdc28b T A 4: 129,621,152 probably null Het
Cd320 T C 17: 33,846,030 S46P possibly damaging Het
Cfap44 G A 16: 44,404,676 E95K possibly damaging Het
Clpp T C 17: 56,992,901 V144A probably damaging Het
Crtam A T 9: 40,992,616 C96S probably damaging Het
D3Ertd254e C T 3: 36,165,069 H414Y probably benign Het
Dcst1 C T 3: 89,353,805 R480H probably benign Het
Dock2 A T 11: 34,464,970 probably benign Het
Ermard A G 17: 15,022,128 T189A probably benign Het
Gm10840 A G 11: 106,161,076 probably benign Het
Gm4845 T A 1: 141,256,860 noncoding transcript Het
Heatr1 A G 13: 12,406,037 E403G probably benign Het
Herc4 A G 10: 63,286,065 I399V probably null Het
Igf2r T C 17: 12,715,495 probably null Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Krt13 T G 11: 100,119,153 K297T probably damaging Het
Lrba T C 3: 86,605,989 probably null Het
Lrrc8b T C 5: 105,480,112 V108A possibly damaging Het
Lrrc8c T A 5: 105,579,548 V26E probably damaging Het
Olfr478 A G 7: 108,032,334 F3S probably benign Het
Olfr981 A G 9: 40,022,999 D202G probably damaging Het
Pcna A G 2: 132,251,235 probably benign Het
Pgm1 A T 5: 64,107,679 R348* probably null Het
Pikfyve T G 1: 65,253,523 S1378A probably damaging Het
Pkp2 T C 16: 16,247,028 V472A probably benign Het
Pld5 A G 1: 175,975,515 F395L probably benign Het
Plekhb1 A T 7: 100,645,603 Y169N probably damaging Het
Polr2c T A 8: 94,862,637 Y186N probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prr5l A G 2: 101,717,474 probably benign Het
Ptbp2 C T 3: 119,720,921 R419Q possibly damaging Het
Ralgapa2 A G 2: 146,388,531 V1038A probably damaging Het
Rassf2 A G 2: 132,002,910 V204A probably damaging Het
Slc22a22 T C 15: 57,256,553 probably null Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smc5 C A 19: 23,208,927 L1055F probably damaging Het
Spidr A G 16: 15,912,781 F620S probably damaging Het
Susd1 A G 4: 59,379,749 S293P possibly damaging Het
Tepsin A G 11: 120,095,337 probably benign Het
Vmn2r68 A T 7: 85,221,586 L830I possibly damaging Het
Vtn A G 11: 78,500,854 probably benign Het
Wdr66 T A 5: 123,256,185 V379E probably damaging Het
Zfp280d T G 9: 72,312,101 S162A possibly damaging Het
Zfp608 T G 18: 54,900,234 K409T probably damaging Het
Zfp738 A T 13: 67,671,524 M116K probably benign Het
Other mutations in Htr1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00896:Htr1f APN 16 64926106 missense probably benign 0.00
IGL01134:Htr1f APN 16 64926138 missense probably benign 0.00
IGL01455:Htr1f APN 16 64926022 missense probably damaging 1.00
IGL01580:Htr1f APN 16 64925835 nonsense probably null
IGL01865:Htr1f APN 16 64925919 missense probably damaging 1.00
IGL02027:Htr1f APN 16 64926321 nonsense probably null
IGL02234:Htr1f APN 16 64926067 missense probably damaging 1.00
IGL02567:Htr1f APN 16 64926248 missense probably benign 0.45
R0035:Htr1f UTSW 16 64926497 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0131:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0132:Htr1f UTSW 16 64926728 missense probably damaging 1.00
R0193:Htr1f UTSW 16 64926749 missense probably damaging 1.00
R0523:Htr1f UTSW 16 64925899 missense probably damaging 1.00
R2055:Htr1f UTSW 16 64926035 missense probably damaging 1.00
R3418:Htr1f UTSW 16 64925897 missense probably damaging 1.00
R4090:Htr1f UTSW 16 64925961 missense probably benign 0.06
R4320:Htr1f UTSW 16 64926687 missense possibly damaging 0.87
R5037:Htr1f UTSW 16 64925928 missense probably damaging 1.00
R6004:Htr1f UTSW 16 64925876 missense probably damaging 1.00
R7383:Htr1f UTSW 16 64926843 missense probably benign 0.00
R7462:Htr1f UTSW 16 64926020 missense probably damaging 0.99
R7864:Htr1f UTSW 16 64926794 missense probably damaging 1.00
R8677:Htr1f UTSW 16 64926051 missense possibly damaging 0.69
R8816:Htr1f UTSW 16 64926174 missense probably benign 0.05
R8836:Htr1f UTSW 16 64926833 missense probably benign
Z1176:Htr1f UTSW 16 64926077 nonsense probably null
Z1176:Htr1f UTSW 16 64926874 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACACTATCAAAGCCGCTGAGCTTC -3'
(R):5'- AAAGCAGCCACTACCCTGGGATTG -3'

Sequencing Primer
(F):5'- CAAAATATTACGAGCTGAGCTGC -3'
(R):5'- TGTAATATGTTGGCTGCCCT -3'
Posted On2013-07-30