Incidental Mutation 'R8203:Ulk4'
ID635773
Institutional Source Beutler Lab
Gene Symbol Ulk4
Ensembl Gene ENSMUSG00000040936
Gene Nameunc-51-like kinase 4
Synonyms4932415A06Rik
MMRRC Submission
Accession Numbers

Genbank: NM_177589; MGI: 1921622

Is this an essential gene? Possibly essential (E-score: 0.647) question?
Stock #R8203 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location120955351-121277197 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 121168208 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 766 (M766K)
Ref Sequence ENSEMBL: ENSMUSP00000057960 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051479] [ENSMUST00000051565] [ENSMUST00000170237] [ENSMUST00000171061] [ENSMUST00000171923]
Predicted Effect probably damaging
Transcript: ENSMUST00000051479
AA Change: M766K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000057960
Gene: ENSMUSG00000040936
AA Change: M766K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 9.9e-26 PFAM
Pfam:Pkinase 4 280 4.6e-49 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1161 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000051565
SMART Domains Protein: ENSMUSP00000054833
Gene: ENSMUSG00000040936

DomainStartEndE-ValueType
SCOP:d1jvpp_ 1 32 9e-6 SMART
Blast:S_TKc 4 45 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000170237
Predicted Effect probably damaging
Transcript: ENSMUST00000171061
AA Change: M766K

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000129214
Gene: ENSMUSG00000040936
AA Change: M766K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 277 4.3e-26 PFAM
Pfam:Pkinase 4 280 2.1e-49 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000171923
AA Change: M766K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131342
Gene: ENSMUSG00000040936
AA Change: M766K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 4 153 3.1e-14 PFAM
Pfam:Pkinase 4 280 4.9e-50 PFAM
Pfam:Pkinase_Tyr 165 277 6.1e-10 PFAM
low complexity region 949 964 N/A INTRINSIC
low complexity region 968 985 N/A INTRINSIC
low complexity region 1107 1119 N/A INTRINSIC
low complexity region 1147 1171 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the unc-51-like serine/threonine kinase (STK) family. Members of this protein family play a role in neuronal growth and endocytosis. The encoded protein is likely involved in neurite branching, neurite elongation and neuronal migration. Genome-wide association studies (GWAS) indicate an association of variations in this gene with blood pressure and hypertension. Sequence variations in this gene may also be be associated with psychiatric disorders, including schizophrenia and bipolar disorder. Pseudogenes associated with this gene have been identified and are located on chromosome 15. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for a null allele show reduced body size, hydrocephaly, dilated brain ventricles, otitis media, and premature death. Hypomorphic mice show partial corpus callosum aplasia, hydrocephaly, subcommissural organ and ependymal motile ciliary defects, aqueduct stenosis, and impaired CSF flow. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, other(1) Gene trapped(1)

Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,043 S2017T probably benign Het
Abcd2 A G 15: 91,191,166 I148T probably benign Het
Agbl3 A G 6: 34,799,479 T307A probably damaging Het
Ahsa1 A G 12: 87,268,268 D65G probably damaging Het
Aicda T C 6: 122,561,117 V78A possibly damaging Het
Arhgef5 A G 6: 43,280,645 D1282G probably damaging Het
Atf7ip T C 6: 136,606,783 S1271P probably damaging Het
Atrn G A 2: 130,960,549 D537N probably benign Het
Cep170 T A 1: 176,769,311 Q493H probably benign Het
Cltc A T 11: 86,704,160 Y1371N possibly damaging Het
Col12a1 T C 9: 79,681,549 T1095A possibly damaging Het
Cxcr5 T C 9: 44,514,154 M69V probably benign Het
Cyp2c69 A T 19: 39,881,140 V145E probably damaging Het
Ddx3y T C Y: 1,269,827 E185G probably benign Het
Dgke G A 11: 89,050,367 A330V probably benign Het
Dyrk4 A G 6: 126,894,834 L157P probably damaging Het
Ermard T A 17: 15,020,286 S337R possibly damaging Het
Etl4 A T 2: 20,785,105 M805L possibly damaging Het
Fmn1 T A 2: 113,525,275 M785K unknown Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabrg3 G A 7: 56,773,260 T230I possibly damaging Het
Gle1 A G 2: 29,935,510 D4G probably benign Het
Gm5468 T C 15: 25,414,441 S26P noncoding transcript Het
Igsf10 A T 3: 59,328,833 L1309Q probably benign Het
Lipf A G 19: 33,966,883 K164R probably benign Het
Luc7l C A 17: 26,266,359 T111K possibly damaging Het
Masp2 A G 4: 148,612,142 T399A probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip1 T C 13: 100,425,820 I946V probably benign Het
Neb T A 2: 52,149,247 K6927* probably null Het
Nipal4 A T 11: 46,150,320 D349E probably damaging Het
Olfr1043 T A 2: 86,162,500 I150F probably benign Het
Olfr527 A T 7: 140,336,026 T55S probably benign Het
Olfr837 A G 9: 19,137,874 N294D probably damaging Het
Pdik1l A T 4: 134,279,365 H154Q unknown Het
Polr2m T G 9: 71,479,486 M338L probably benign Het
Rab3gap2 T C 1: 185,267,179 L995P probably damaging Het
Rnf17 T A 14: 56,467,722 H694Q probably benign Het
Sar1b A G 11: 51,779,697 K23E probably benign Het
Setd7 A T 3: 51,530,098 Y245* probably null Het
Shpk A C 11: 73,214,078 D171A probably benign Het
Slc2a7 G T 4: 150,158,558 E279* probably null Het
Slco4a1 T C 2: 180,464,799 V258A probably damaging Het
Srcin1 G T 11: 97,566,713 P62Q probably damaging Het
Tbc1d2 A G 4: 46,606,476 F823S probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd9 T A 12: 112,025,630 V613E probably damaging Het
Tsc1 A G 2: 28,672,995 probably null Het
Wdr36 G T 18: 32,852,083 G481* probably null Het
Yme1l1 G A 2: 23,164,526 R119H probably benign Het
Zfp106 G A 2: 120,519,078 T1644I probably damaging Het
Other mutations in Ulk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Ulk4 APN 9 121168292 missense possibly damaging 0.48
IGL01345:Ulk4 APN 9 121208162 missense possibly damaging 0.48
IGL01432:Ulk4 APN 9 121266301 missense probably damaging 1.00
IGL01807:Ulk4 APN 9 121255185 missense probably damaging 1.00
IGL02139:Ulk4 APN 9 121141831 splice site probably null
IGL02266:Ulk4 APN 9 121081700 missense probably benign 0.10
IGL02511:Ulk4 APN 9 121188354 missense probably damaging 1.00
IGL02546:Ulk4 APN 9 121152307 nonsense probably null
IGL02687:Ulk4 APN 9 121192662 missense possibly damaging 0.89
IGL03220:Ulk4 APN 9 121145336 missense probably damaging 1.00
3-1:Ulk4 UTSW 9 121255171 missense probably benign 0.02
R0031:Ulk4 UTSW 9 121272982 missense probably damaging 1.00
R0433:Ulk4 UTSW 9 121044819 missense probably benign 0.27
R0513:Ulk4 UTSW 9 121152325 missense probably benign 0.13
R0524:Ulk4 UTSW 9 121252651 critical splice donor site probably null
R1268:Ulk4 UTSW 9 121257074 splice site probably benign
R1439:Ulk4 UTSW 9 121266258 missense possibly damaging 0.58
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1470:Ulk4 UTSW 9 121081656 missense probably benign 0.00
R1531:Ulk4 UTSW 9 121044775 missense probably damaging 0.97
R1595:Ulk4 UTSW 9 121044838 missense probably damaging 0.96
R1620:Ulk4 UTSW 9 121204805 missense possibly damaging 0.81
R1835:Ulk4 UTSW 9 121168184 missense probably null 1.00
R1966:Ulk4 UTSW 9 121257116 missense probably benign
R2129:Ulk4 UTSW 9 121152182 missense probably benign 0.03
R2329:Ulk4 UTSW 9 121272887 missense probably damaging 1.00
R2877:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R2878:Ulk4 UTSW 9 121260039 missense probably benign 0.11
R3734:Ulk4 UTSW 9 121261989 missense probably benign 0.21
R3769:Ulk4 UTSW 9 121263700 missense probably benign 0.00
R4005:Ulk4 UTSW 9 121168199 missense possibly damaging 0.94
R4024:Ulk4 UTSW 9 121044849 missense possibly damaging 0.86
R4321:Ulk4 UTSW 9 121073996 missense probably benign 0.00
R4461:Ulk4 UTSW 9 121156884 missense possibly damaging 0.83
R4537:Ulk4 UTSW 9 121263638 nonsense probably null
R4542:Ulk4 UTSW 9 121263638 nonsense probably null
R4572:Ulk4 UTSW 9 121192764 missense probably damaging 1.00
R4647:Ulk4 UTSW 9 121141852 missense probably benign 0.15
R4712:Ulk4 UTSW 9 121244370 missense probably benign 0.23
R4730:Ulk4 UTSW 9 121263725 missense probably benign 0.05
R4731:Ulk4 UTSW 9 121263638 nonsense probably null
R4732:Ulk4 UTSW 9 121263638 nonsense probably null
R4733:Ulk4 UTSW 9 121263638 nonsense probably null
R4737:Ulk4 UTSW 9 121073872 nonsense probably null
R4781:Ulk4 UTSW 9 121103576 missense probably benign 0.00
R4860:Ulk4 UTSW 9 121250902 missense possibly damaging 0.68
R4926:Ulk4 UTSW 9 121258732 missense probably benign 0.00
R4990:Ulk4 UTSW 9 121192786 missense probably benign 0.01
R6056:Ulk4 UTSW 9 121272955 missense probably damaging 1.00
R6448:Ulk4 UTSW 9 121103630 missense probably damaging 0.99
R6546:Ulk4 UTSW 9 121141894 missense probably damaging 1.00
R6668:Ulk4 UTSW 9 121188342 missense probably damaging 1.00
R6915:Ulk4 UTSW 9 121258820 missense probably benign
R6929:Ulk4 UTSW 9 121074015 missense probably benign 0.02
R7069:Ulk4 UTSW 9 121258810 missense probably benign 0.01
R7069:Ulk4 UTSW 9 121266517 missense probably benign 0.25
R7293:Ulk4 UTSW 9 121255124 missense probably damaging 1.00
R7299:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7301:Ulk4 UTSW 9 121145059 missense probably benign 0.32
R7337:Ulk4 UTSW 9 121248927 missense probably benign 0.44
R7395:Ulk4 UTSW 9 121255112 missense probably benign
R7423:Ulk4 UTSW 9 121103621 missense possibly damaging 0.48
R7545:Ulk4 UTSW 9 121141838 missense probably benign 0.00
R7753:Ulk4 UTSW 9 121266512 critical splice donor site probably null
R7790:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7791:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7793:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7834:Ulk4 UTSW 9 121263668 missense possibly damaging 0.70
R7836:Ulk4 UTSW 9 121044819 missense possibly damaging 0.72
R7960:Ulk4 UTSW 9 121272956 missense probably damaging 1.00
R8087:Ulk4 UTSW 9 121266251 missense probably damaging 0.99
R8246:Ulk4 UTSW 9 121156875 makesense probably null
R8430:Ulk4 UTSW 9 121257078 critical splice donor site probably null
X0024:Ulk4 UTSW 9 121192753 missense probably damaging 1.00
X0066:Ulk4 UTSW 9 121262606 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTTGGGAAGGCTGAAG -3'
(R):5'- ACTAAGGACACAACGTGGCTG -3'

Sequencing Primer
(F):5'- CCCTGGGATGTATTAAACTCCTGAG -3'
(R):5'- CACAACGTGGCTGAGGAGATTTTATC -3'
Posted On2020-07-13