Incidental Mutation 'R0722:Ermard'
ID63578
Institutional Source Beutler Lab
Gene Symbol Ermard
Ensembl Gene ENSMUSG00000036552
Gene NameER membrane associated RNA degradation
Synonyms2410011O22Rik, 2210404J11Rik
MMRRC Submission 038904-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0722 (G1)
Quality Score168
Status Validated
Chromosome17
Chromosomal Location15041208-15090044 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 15022128 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 189 (T189A)
Ref Sequence ENSEMBL: ENSMUSP00000156195 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097395] [ENSMUST00000097400] [ENSMUST00000232446]
Predicted Effect unknown
Transcript: ENSMUST00000097395
AA Change: T425A
SMART Domains Protein: ENSMUSP00000095007
Gene: ENSMUSG00000116895
AA Change: T425A

DomainStartEndE-ValueType
Pfam:DUF4209 133 214 1.8e-27 PFAM
low complexity region 390 399 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097400
SMART Domains Protein: ENSMUSP00000095012
Gene: ENSMUSG00000079710

DomainStartEndE-ValueType
Pfam:Tctex-1 91 190 2.1e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232446
AA Change: T189A

PolyPhen 2 Score 0.127 (Sensitivity: 0.93; Specificity: 0.86)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 91.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 transmembrane domains near the C-terminus and is localized in the endoplasmic reticulum. Knockout of this gene in developing rat brain showed that it may be involved in neuronal migration. Mutations in this gene are associated with periventricular nodular heterotopia-6 (PVNH6). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adap2 T C 11: 80,156,984 F89L possibly damaging Het
Akr1c13 A G 13: 4,197,932 probably null Het
Atp10a A G 7: 58,816,183 I1053V possibly damaging Het
Bmper G T 9: 23,373,928 V258L probably benign Het
Brd4 T C 17: 32,212,982 H636R possibly damaging Het
Cacna2d4 C T 6: 119,307,286 R745W probably damaging Het
Ccbe1 C T 18: 66,084,806 C112Y probably damaging Het
Ccdc28b T A 4: 129,621,152 probably null Het
Cd320 T C 17: 33,846,030 S46P possibly damaging Het
Cfap44 G A 16: 44,404,676 E95K possibly damaging Het
Clpp T C 17: 56,992,901 V144A probably damaging Het
Crtam A T 9: 40,992,616 C96S probably damaging Het
D3Ertd254e C T 3: 36,165,069 H414Y probably benign Het
Dcst1 C T 3: 89,353,805 R480H probably benign Het
Dock2 A T 11: 34,464,970 probably benign Het
Gm10840 A G 11: 106,161,076 probably benign Het
Gm4845 T A 1: 141,256,860 noncoding transcript Het
Heatr1 A G 13: 12,406,037 E403G probably benign Het
Herc4 A G 10: 63,286,065 I399V probably null Het
Htr1f A G 16: 64,925,891 I346T probably damaging Het
Igf2r T C 17: 12,715,495 probably null Het
Jmy G A 13: 93,452,817 T644I probably benign Het
Kcnn2 T C 18: 45,559,476 C40R possibly damaging Het
Krt13 T G 11: 100,119,153 K297T probably damaging Het
Lrba T C 3: 86,605,989 probably null Het
Lrrc8b T C 5: 105,480,112 V108A possibly damaging Het
Lrrc8c T A 5: 105,579,548 V26E probably damaging Het
Olfr478 A G 7: 108,032,334 F3S probably benign Het
Olfr981 A G 9: 40,022,999 D202G probably damaging Het
Pcna A G 2: 132,251,235 probably benign Het
Pgm1 A T 5: 64,107,679 R348* probably null Het
Pikfyve T G 1: 65,253,523 S1378A probably damaging Het
Pkp2 T C 16: 16,247,028 V472A probably benign Het
Pld5 A G 1: 175,975,515 F395L probably benign Het
Plekhb1 A T 7: 100,645,603 Y169N probably damaging Het
Polr2c T A 8: 94,862,637 Y186N probably damaging Het
Ppp1r16a C T 15: 76,693,669 Q328* probably null Het
Prr5l A G 2: 101,717,474 probably benign Het
Ptbp2 C T 3: 119,720,921 R419Q possibly damaging Het
Ralgapa2 A G 2: 146,388,531 V1038A probably damaging Het
Rassf2 A G 2: 132,002,910 V204A probably damaging Het
Slc22a22 T C 15: 57,256,553 probably null Het
Slit1 T C 19: 41,608,435 Y1075C probably damaging Het
Smc5 C A 19: 23,208,927 L1055F probably damaging Het
Spidr A G 16: 15,912,781 F620S probably damaging Het
Susd1 A G 4: 59,379,749 S293P possibly damaging Het
Tepsin A G 11: 120,095,337 probably benign Het
Vmn2r68 A T 7: 85,221,586 L830I possibly damaging Het
Vtn A G 11: 78,500,854 probably benign Het
Wdr66 T A 5: 123,256,185 V379E probably damaging Het
Zfp280d T G 9: 72,312,101 S162A possibly damaging Het
Zfp608 T G 18: 54,900,234 K409T probably damaging Het
Zfp738 A T 13: 67,671,524 M116K probably benign Het
Other mutations in Ermard
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Ermard APN 17 14988066 splice site probably benign
IGL01554:Ermard APN 17 15051593 missense possibly damaging 0.94
IGL01832:Ermard APN 17 15059849 missense probably damaging 0.98
IGL02045:Ermard APN 17 15051564 unclassified probably benign
IGL02332:Ermard APN 17 14990545 critical splice acceptor site probably null
IGL02525:Ermard APN 17 15059339 splice site probably benign
IGL03335:Ermard APN 17 15059406 missense probably damaging 1.00
Eminence UTSW 17 15053205 splice site probably null
PIT4504001:Ermard UTSW 17 15058822 nonsense probably null
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0211:Ermard UTSW 17 15021943 missense probably damaging 0.99
R0785:Ermard UTSW 17 15021977 missense probably damaging 1.00
R2019:Ermard UTSW 17 15053265 missense probably damaging 1.00
R3696:Ermard UTSW 17 15053376 missense probably benign 0.01
R3697:Ermard UTSW 17 15053376 missense probably benign 0.01
R4077:Ermard UTSW 17 15053376 missense probably benign 0.04
R4383:Ermard UTSW 17 15059866 missense possibly damaging 0.87
R5424:Ermard UTSW 17 15059770 missense possibly damaging 0.73
R6313:Ermard UTSW 17 15053205 splice site probably null
R7685:Ermard UTSW 17 15059462 missense probably benign 0.00
R7800:Ermard UTSW 17 15056803 missense probably benign 0.01
R7802:Ermard UTSW 17 15061161 missense probably benign
R7895:Ermard UTSW 17 15063613 missense possibly damaging 0.66
R7978:Ermard UTSW 17 15063613 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- ATCTGCCCAGAACACTGACAGAATG -3'
(R):5'- TGCTCCATCAGTTTAGCAGGCAC -3'

Sequencing Primer
(F):5'- CAGAACACTGACAGAATGTTTCTC -3'
(R):5'- TGGTTTTTAACACTGACACTGC -3'
Posted On2013-07-30