Incidental Mutation 'R8203:Rnf17'
ID635784
Institutional Source Beutler Lab
Gene Symbol Rnf17
Ensembl Gene ENSMUSG00000000365
Gene Namering finger protein 17
SynonymsMMIP-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.384) question?
Stock #R8203 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location56402581-56525032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56467722 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 694 (H694Q)
Ref Sequence ENSEMBL: ENSMUSP00000093469 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095793]
Predicted Effect probably benign
Transcript: ENSMUST00000095793
AA Change: H694Q

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: H694Q

DomainStartEndE-ValueType
Blast:RING 9 72 2e-15 BLAST
low complexity region 398 405 N/A INTRINSIC
Pfam:TUDOR 440 522 8.2e-8 PFAM
TUDOR 750 807 4.32e-12 SMART
low complexity region 824 836 N/A INTRINSIC
Blast:TUDOR 850 882 1e-8 BLAST
low complexity region 959 970 N/A INTRINSIC
TUDOR 984 1042 1.29e-1 SMART
low complexity region 1128 1139 N/A INTRINSIC
TUDOR 1245 1301 7.7e-9 SMART
low complexity region 1416 1430 N/A INTRINSIC
TUDOR 1495 1554 1e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,716,043 S2017T probably benign Het
Abcd2 A G 15: 91,191,166 I148T probably benign Het
Agbl3 A G 6: 34,799,479 T307A probably damaging Het
Ahsa1 A G 12: 87,268,268 D65G probably damaging Het
Aicda T C 6: 122,561,117 V78A possibly damaging Het
Arhgef5 A G 6: 43,280,645 D1282G probably damaging Het
Atf7ip T C 6: 136,606,783 S1271P probably damaging Het
Atrn G A 2: 130,960,549 D537N probably benign Het
Cep170 T A 1: 176,769,311 Q493H probably benign Het
Cltc A T 11: 86,704,160 Y1371N possibly damaging Het
Col12a1 T C 9: 79,681,549 T1095A possibly damaging Het
Cxcr5 T C 9: 44,514,154 M69V probably benign Het
Cyp2c69 A T 19: 39,881,140 V145E probably damaging Het
Ddx3y T C Y: 1,269,827 E185G probably benign Het
Dgke G A 11: 89,050,367 A330V probably benign Het
Dyrk4 A G 6: 126,894,834 L157P probably damaging Het
Ermard T A 17: 15,020,286 S337R possibly damaging Het
Etl4 A T 2: 20,785,105 M805L possibly damaging Het
Fmn1 T A 2: 113,525,275 M785K unknown Het
Fmn2 CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC 1: 174,609,203 probably benign Het
Gabrg3 G A 7: 56,773,260 T230I possibly damaging Het
Gle1 A G 2: 29,935,510 D4G probably benign Het
Gm5468 T C 15: 25,414,441 S26P noncoding transcript Het
Igsf10 A T 3: 59,328,833 L1309Q probably benign Het
Lipf A G 19: 33,966,883 K164R probably benign Het
Luc7l C A 17: 26,266,359 T111K possibly damaging Het
Masp2 A G 4: 148,612,142 T399A probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip1 T C 13: 100,425,820 I946V probably benign Het
Neb T A 2: 52,149,247 K6927* probably null Het
Nipal4 A T 11: 46,150,320 D349E probably damaging Het
Olfr1043 T A 2: 86,162,500 I150F probably benign Het
Olfr527 A T 7: 140,336,026 T55S probably benign Het
Olfr837 A G 9: 19,137,874 N294D probably damaging Het
Pdik1l A T 4: 134,279,365 H154Q unknown Het
Polr2m T G 9: 71,479,486 M338L probably benign Het
Rab3gap2 T C 1: 185,267,179 L995P probably damaging Het
Sar1b A G 11: 51,779,697 K23E probably benign Het
Setd7 A T 3: 51,530,098 Y245* probably null Het
Shpk A C 11: 73,214,078 D171A probably benign Het
Slc2a7 G T 4: 150,158,558 E279* probably null Het
Slco4a1 T C 2: 180,464,799 V258A probably damaging Het
Srcin1 G T 11: 97,566,713 P62Q probably damaging Het
Tbc1d2 A G 4: 46,606,476 F823S probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tdrd9 T A 12: 112,025,630 V613E probably damaging Het
Ulk4 A T 9: 121,168,208 M766K probably damaging Het
Wdr36 G T 18: 32,852,083 G481* probably null Het
Yme1l1 G A 2: 23,164,526 R119H probably benign Het
Zfp106 G A 2: 120,519,078 T1644I probably damaging Het
Other mutations in Rnf17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Rnf17 APN 14 56421082 missense probably damaging 0.99
IGL00717:Rnf17 APN 14 56465750 missense probably benign 0.00
IGL00978:Rnf17 APN 14 56512271 missense probably damaging 1.00
IGL01295:Rnf17 APN 14 56463064 nonsense probably null
IGL01779:Rnf17 APN 14 56462063 missense probably benign 0.06
IGL02132:Rnf17 APN 14 56421166 missense probably benign 0.27
IGL02183:Rnf17 APN 14 56507868 missense probably null 0.99
IGL02387:Rnf17 APN 14 56500587 missense probably damaging 1.00
IGL02422:Rnf17 APN 14 56482135 missense probably damaging 1.00
IGL03081:Rnf17 APN 14 56434371 missense probably benign 0.03
IGL03269:Rnf17 APN 14 56427946 missense possibly damaging 0.74
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0046:Rnf17 UTSW 14 56471373 missense probably damaging 1.00
R0089:Rnf17 UTSW 14 56514106 missense probably damaging 1.00
R0189:Rnf17 UTSW 14 56482193 missense probably null 1.00
R0243:Rnf17 UTSW 14 56482084 missense possibly damaging 0.80
R0245:Rnf17 UTSW 14 56438609 missense probably damaging 0.97
R0486:Rnf17 UTSW 14 56514175 missense probably benign 0.43
R0554:Rnf17 UTSW 14 56522550 missense probably damaging 1.00
R0840:Rnf17 UTSW 14 56475447 missense probably damaging 1.00
R1169:Rnf17 UTSW 14 56514165 missense possibly damaging 0.89
R1170:Rnf17 UTSW 14 56425631 missense probably benign 0.10
R1200:Rnf17 UTSW 14 56467706 missense probably benign 0.44
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1464:Rnf17 UTSW 14 56461911 missense probably damaging 1.00
R1472:Rnf17 UTSW 14 56427979 missense probably damaging 1.00
R1512:Rnf17 UTSW 14 56467786 missense probably benign 0.01
R1605:Rnf17 UTSW 14 56493365 missense probably damaging 1.00
R1778:Rnf17 UTSW 14 56522399 missense probably damaging 0.99
R1791:Rnf17 UTSW 14 56504007 nonsense probably null
R2015:Rnf17 UTSW 14 56486969 missense probably benign 0.00
R2023:Rnf17 UTSW 14 56431579 missense possibly damaging 0.59
R2086:Rnf17 UTSW 14 56483380 missense probably damaging 0.98
R2130:Rnf17 UTSW 14 56493354 missense probably damaging 1.00
R2309:Rnf17 UTSW 14 56505982 missense possibly damaging 0.95
R3003:Rnf17 UTSW 14 56500547 missense probably damaging 1.00
R3611:Rnf17 UTSW 14 56467740 missense probably benign 0.43
R3847:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3848:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3849:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3850:Rnf17 UTSW 14 56512296 missense probably damaging 1.00
R3872:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R3874:Rnf17 UTSW 14 56475413 missense possibly damaging 0.89
R4021:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4022:Rnf17 UTSW 14 56460001 missense probably damaging 0.98
R4790:Rnf17 UTSW 14 56434355 missense probably damaging 1.00
R4951:Rnf17 UTSW 14 56522391 missense probably benign 0.02
R5068:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5069:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5070:Rnf17 UTSW 14 56505928 missense probably damaging 0.99
R5518:Rnf17 UTSW 14 56482133 missense probably damaging 1.00
R5628:Rnf17 UTSW 14 56486952 splice site probably null
R5712:Rnf17 UTSW 14 56471399 missense probably benign 0.19
R5747:Rnf17 UTSW 14 56465819 critical splice donor site probably null
R5869:Rnf17 UTSW 14 56505988 missense possibly damaging 0.94
R6336:Rnf17 UTSW 14 56421169 splice site probably null
R6626:Rnf17 UTSW 14 56427924 missense possibly damaging 0.92
R6639:Rnf17 UTSW 14 56438743 missense probably benign 0.01
R6675:Rnf17 UTSW 14 56459975 missense probably damaging 1.00
R6731:Rnf17 UTSW 14 56524350 missense possibly damaging 0.93
R7062:Rnf17 UTSW 14 56465654 missense probably benign 0.00
R7103:Rnf17 UTSW 14 56471306 missense possibly damaging 0.63
R7144:Rnf17 UTSW 14 56512332 splice site probably null
R7527:Rnf17 UTSW 14 56516438 missense probably damaging 1.00
R7664:Rnf17 UTSW 14 56438878 missense probably damaging 1.00
R7754:Rnf17 UTSW 14 56462072 critical splice donor site probably null
R7772:Rnf17 UTSW 14 56477687 missense probably benign 0.27
R8092:Rnf17 UTSW 14 56487022 missense probably benign 0.00
R8150:Rnf17 UTSW 14 56421136 missense probably benign 0.19
R8320:Rnf17 UTSW 14 56424542 frame shift probably null
R8321:Rnf17 UTSW 14 56424542 frame shift probably null
R8379:Rnf17 UTSW 14 56424542 frame shift probably null
R8380:Rnf17 UTSW 14 56424542 frame shift probably null
R8381:Rnf17 UTSW 14 56424542 frame shift probably null
R8382:Rnf17 UTSW 14 56424542 frame shift probably null
R8383:Rnf17 UTSW 14 56424542 frame shift probably null
Z1177:Rnf17 UTSW 14 56467706 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TTACAGGGCTAAATAAGTGGAAACC -3'
(R):5'- ACTTCCTGTTGTTTATAGTTGCAGC -3'

Sequencing Primer
(F):5'- GCTAAATAAGTGGAAACCATGCC -3'
(R):5'- GTTGCAGCTTCTAAGAAGTTTAAACG -3'
Posted On2020-07-13