Incidental Mutation 'R8204:Olfr1278'
ID635798
Institutional Source Beutler Lab
Gene Symbol Olfr1278
Ensembl Gene ENSMUSG00000068647
Gene Nameolfactory receptor 1278
SynonymsGA_x6K02T2Q125-72343713-72344654, MOR245-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8204 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111290136-111298886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111293140 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 291 (R291G)
Ref Sequence ENSEMBL: ENSMUSP00000087802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090330]
Predicted Effect probably damaging
Transcript: ENSMUST00000090330
AA Change: R291G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087802
Gene: ENSMUSG00000068647
AA Change: R291G

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 2.3e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 281 5.3e-6 PFAM
Pfam:7tm_1 41 288 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,166,780 R731H probably benign Het
Adrbk2 A G 5: 112,957,359 F171L probably benign Het
Arpp21 T A 9: 112,136,570 Y408F noncoding transcript Het
Atr T C 9: 95,935,513 S2086P Het
BC034090 C A 1: 155,241,742 G210V probably damaging Het
Cdk6 A G 5: 3,344,461 D32G probably damaging Het
Cep126 C T 9: 8,120,780 E81K probably damaging Het
Clec4d T A 6: 123,265,364 V25D probably damaging Het
Cox8a A G 19: 7,215,480 I40T probably benign Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dlg5 A G 14: 24,160,252 L792P probably damaging Het
Egln3 T C 12: 54,203,224 Y113C probably benign Het
Exoc6b C T 6: 84,855,522 V397M probably damaging Het
Fat2 A T 11: 55,284,610 L1759Q probably benign Het
Flg2 T A 3: 93,202,767 S701T unknown Het
Fopnl T C 16: 14,300,206 D150G probably benign Het
Git1 G A 11: 77,505,335 D551N probably benign Het
Gpr137 C T 19: 6,940,378 A21T probably benign Het
Hk1 A G 10: 62,296,744 F175S probably damaging Het
Hoxc13 A G 15: 102,927,360 N308D probably damaging Het
Itga9 A G 9: 118,871,921 N924S probably damaging Het
Klhl20 T C 1: 161,106,844 M202V probably benign Het
Krtap19-9a C T 16: 88,924,108 G37D noncoding transcript Het
Lancl2 C A 6: 57,737,716 P440Q probably damaging Het
Lrba T C 3: 86,315,403 I608T possibly damaging Het
Lrtm2 T A 6: 119,317,408 E254V probably benign Het
Magi3 A T 3: 104,051,186 C528S probably benign Het
Mast3 T C 8: 70,788,281 D224G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myrip G A 9: 120,432,979 probably null Het
Olfr313 A C 11: 58,817,059 D17A probably benign Het
Plekhg6 C T 6: 125,363,498 R633H probably damaging Het
Ppp1r7 T C 1: 93,365,011 V344A possibly damaging Het
Ppp2r1a A G 17: 20,956,773 E191G probably benign Het
Prkag2 T C 5: 24,869,127 probably null Het
Pyroxd2 A T 19: 42,749,388 V48E probably benign Het
Sacs T C 14: 61,212,948 S4148P probably damaging Het
Sh3tc2 T C 18: 61,953,129 F5S probably damaging Het
Skint8 T C 4: 111,938,893 S255P probably benign Het
Tacc2 A T 7: 130,624,429 Q948L probably damaging Het
Tcerg1 T A 18: 42,574,553 L1046Q probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfcp2 G T 15: 100,522,448 Q169K possibly damaging Het
Tpp1 A T 7: 105,750,315 L82Q probably damaging Het
Trpc7 A G 13: 56,783,796 S697P probably benign Het
Vmn1r55 A T 7: 5,147,286 I46N possibly damaging Het
Wdfy3 A G 5: 101,852,585 V2973A probably benign Het
Xrcc1 T C 7: 24,572,284 V564A possibly damaging Het
Other mutations in Olfr1278
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1278 APN 2 111292519 missense probably benign 0.11
IGL02301:Olfr1278 APN 2 111292697 missense probably benign 0.03
IGL02480:Olfr1278 APN 2 111292513 missense possibly damaging 0.66
IGL03056:Olfr1278 APN 2 111293172 missense possibly damaging 0.90
IGL03327:Olfr1278 APN 2 111292462 missense probably damaging 1.00
R0284:Olfr1278 UTSW 2 111292586 missense probably benign 0.34
R1614:Olfr1278 UTSW 2 111293066 missense probably damaging 0.97
R1698:Olfr1278 UTSW 2 111292560 nonsense probably null
R1733:Olfr1278 UTSW 2 111292865 missense probably damaging 0.98
R2265:Olfr1278 UTSW 2 111293179 missense probably benign 0.01
R4857:Olfr1278 UTSW 2 111293143 missense possibly damaging 0.95
R5061:Olfr1278 UTSW 2 111292487 missense probably damaging 1.00
R5208:Olfr1278 UTSW 2 111292601 missense probably damaging 1.00
R5940:Olfr1278 UTSW 2 111292384 missense possibly damaging 0.80
R6355:Olfr1278 UTSW 2 111292885 missense probably benign 0.05
R6820:Olfr1278 UTSW 2 111293110 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAACAGTGGGTTTATTTCCATGGG -3'
(R):5'- CCGTATCTATAAGATGCTGGATATAGG -3'

Sequencing Primer
(F):5'- CATCATCAGGTGATTTGTCCAAGGC -3'
(R):5'- GCTGGATATAGGATAATAAACTGCC -3'
Posted On2020-07-13