Mutagenetix > Incidental Mutation

Incidental Mutation 'R8204:Mast3'

635817

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8204 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70788281 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 224 (D224G)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212001] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: D224G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: D224G

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: D208G

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

probably benign
Transcript: ENSMUST00000212001

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 99.9%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

98% (51/52)

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	C	T	11: 72,166,780	R731H	probably benign	Het
Arpp21	T	A	9: 112,136,570	Y408F	noncoding transcript	Het
Atr	T	C	9: 95,935,513	S2086P		Het
BC034090	C	A	1: 155,241,742	G210V	probably damaging	Het
Cdk6	A	G	5: 3,344,461	D32G	probably damaging	Het
Cep126	C	T	9: 8,120,780	E81K	probably damaging	Het
Clec4d	T	A	6: 123,265,364	V25D	probably damaging	Het
Cox8a	A	G	19: 7,215,480	I40T	probably benign	Het
D430042O09Rik	C	T	7: 125,850,742	R993C	probably damaging	Het
Dlg5	A	G	14: 24,160,252	L792P	probably damaging	Het
Egln3	T	C	12: 54,203,224	Y113C	probably benign	Het
Exoc6b	C	T	6: 84,855,522	V397M	probably damaging	Het
Fat2	A	T	11: 55,284,610	L1759Q	probably benign	Het
Flg2	T	A	3: 93,202,767	S701T	unknown	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fopnl	T	C	16: 14,300,206	D150G	probably benign	Het
Git1	G	A	11: 77,505,335	D551N	probably benign	Het
Gpr137	C	T	19: 6,940,378	A21T	probably benign	Het
Grk3	A	G	5: 112,957,359	F171L	probably benign	Het
Hk1	A	G	10: 62,296,744	F175S	probably damaging	Het
Hoxc13	A	G	15: 102,927,360	N308D	probably damaging	Het
Itga9	A	G	9: 118,871,921	N924S	probably damaging	Het
Klhl20	T	C	1: 161,106,844	M202V	probably benign	Het
Krtap19-9a	C	T	16: 88,924,108	G37D	noncoding transcript	Het
Lancl2	C	A	6: 57,737,716	P440Q	probably damaging	Het
Lrba	T	C	3: 86,315,403	I608T	possibly damaging	Het
Lrtm2	T	A	6: 119,317,408	E254V	probably benign	Het
Magi3	A	T	3: 104,051,186	C528S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Myrip	G	A	9: 120,432,979		probably null	Het
Olfr1278	A	G	2: 111,293,140	R291G	probably damaging	Het
Olfr313	A	C	11: 58,817,059	D17A	probably benign	Het
Plekhg6	C	T	6: 125,363,498	R633H	probably damaging	Het
Ppp1r7	T	C	1: 93,365,011	V344A	possibly damaging	Het
Ppp2r1a	A	G	17: 20,956,773	E191G	probably benign	Het
Prkag2	T	C	5: 24,869,127		probably null	Het
Pyroxd2	A	T	19: 42,749,388	V48E	probably benign	Het
Sacs	T	C	14: 61,212,948	S4148P	probably damaging	Het
Sh3tc2	T	C	18: 61,953,129	F5S	probably damaging	Het
Skint8	T	C	4: 111,938,893	S255P	probably benign	Het
Tacc2	A	T	7: 130,624,429	Q948L	probably damaging	Het
Tcerg1	T	A	18: 42,574,553	L1046Q	probably damaging	Het
Tcof1	G	C	18: 60,829,051	A702G	possibly damaging	Het
Tfcp2	G	T	15: 100,522,448	Q169K	possibly damaging	Het
Tpp1	A	T	7: 105,750,315	L82Q	probably damaging	Het
Trpc7	A	G	13: 56,783,796	S697P	probably benign	Het
Vmn1r55	A	T	7: 5,147,286	I46N	possibly damaging	Het
Wdfy3	A	G	5: 101,852,585	V2973A	probably benign	Het
Xrcc1	T	C	7: 24,572,284	V564A	possibly damaging	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1738:Mast3	UTSW	8	70784556	missense	probably benign	0.38
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTATAGGGGACAGCCATG -3'
(R):5'- TGCCTGTCCTGTCTGACGATAG -3'

Sequencing Primer
(F):5'- ATGGCTCCGCAGACTCCAC -3'
(R):5'- TGTCTGACGATAGCCCCG -3'

Posted On

2020-07-13