Incidental Mutation 'R8204:Myrip'
ID635822
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Namemyosin VIIA and Rab interacting protein
SynonymsA230081N12Rik, Slac2-c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8204 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location120301513-120474841 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 120432979 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
Predicted Effect probably null
Transcript: ENSMUST00000048121
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,166,780 R731H probably benign Het
Adrbk2 A G 5: 112,957,359 F171L probably benign Het
Arpp21 T A 9: 112,136,570 Y408F noncoding transcript Het
Atr T C 9: 95,935,513 S2086P Het
BC034090 C A 1: 155,241,742 G210V probably damaging Het
Cdk6 A G 5: 3,344,461 D32G probably damaging Het
Cep126 C T 9: 8,120,780 E81K probably damaging Het
Clec4d T A 6: 123,265,364 V25D probably damaging Het
Cox8a A G 19: 7,215,480 I40T probably benign Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dlg5 A G 14: 24,160,252 L792P probably damaging Het
Egln3 T C 12: 54,203,224 Y113C probably benign Het
Exoc6b C T 6: 84,855,522 V397M probably damaging Het
Fat2 A T 11: 55,284,610 L1759Q probably benign Het
Flg2 T A 3: 93,202,767 S701T unknown Het
Fopnl T C 16: 14,300,206 D150G probably benign Het
Git1 G A 11: 77,505,335 D551N probably benign Het
Gpr137 C T 19: 6,940,378 A21T probably benign Het
Hk1 A G 10: 62,296,744 F175S probably damaging Het
Hoxc13 A G 15: 102,927,360 N308D probably damaging Het
Itga9 A G 9: 118,871,921 N924S probably damaging Het
Klhl20 T C 1: 161,106,844 M202V probably benign Het
Krtap19-9a C T 16: 88,924,108 G37D noncoding transcript Het
Lancl2 C A 6: 57,737,716 P440Q probably damaging Het
Lrba T C 3: 86,315,403 I608T possibly damaging Het
Lrtm2 T A 6: 119,317,408 E254V probably benign Het
Magi3 A T 3: 104,051,186 C528S probably benign Het
Mast3 T C 8: 70,788,281 D224G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1278 A G 2: 111,293,140 R291G probably damaging Het
Olfr313 A C 11: 58,817,059 D17A probably benign Het
Plekhg6 C T 6: 125,363,498 R633H probably damaging Het
Ppp1r7 T C 1: 93,365,011 V344A possibly damaging Het
Ppp2r1a A G 17: 20,956,773 E191G probably benign Het
Pyroxd2 A T 19: 42,749,388 V48E probably benign Het
Sacs T C 14: 61,212,948 S4148P probably damaging Het
Sh3tc2 T C 18: 61,953,129 F5S probably damaging Het
Skint8 T C 4: 111,938,893 S255P probably benign Het
Tacc2 A T 7: 130,624,429 Q948L probably damaging Het
Tcerg1 T A 18: 42,574,553 L1046Q probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfcp2 G T 15: 100,522,448 Q169K possibly damaging Het
Tpp1 A T 7: 105,750,315 L82Q probably damaging Het
Trpc7 A G 13: 56,783,796 S697P probably benign Het
Vmn1r55 A T 7: 5,147,286 I46N possibly damaging Het
Wdfy3 A G 5: 101,852,585 V2973A probably benign Het
Xrcc1 T C 7: 24,572,284 V564A possibly damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120388264 missense probably damaging 1.00
IGL02108:Myrip APN 9 120467565 critical splice donor site probably null
IGL02406:Myrip APN 9 120467532 missense probably benign
IGL02876:Myrip APN 9 120432674 missense probably damaging 1.00
IGL03109:Myrip APN 9 120453724 splice site probably null
IGL03258:Myrip APN 9 120441352 missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120467517 missense probably damaging 0.98
R0485:Myrip UTSW 9 120441377 missense probably benign 0.01
R0633:Myrip UTSW 9 120388236 missense probably damaging 1.00
R1489:Myrip UTSW 9 120432529 missense probably damaging 1.00
R1539:Myrip UTSW 9 120424623 missense probably benign 0.00
R1708:Myrip UTSW 9 120464774 missense possibly damaging 0.65
R1817:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1818:Myrip UTSW 9 120388162 missense probably damaging 1.00
R1878:Myrip UTSW 9 120424655 missense probably damaging 0.99
R2484:Myrip UTSW 9 120424619 missense probably benign 0.00
R3237:Myrip UTSW 9 120441407 missense possibly damaging 0.91
R3890:Myrip UTSW 9 120422258 missense probably damaging 1.00
R3912:Myrip UTSW 9 120432616 missense probably benign
R3919:Myrip UTSW 9 120432629 missense probably damaging 1.00
R4125:Myrip UTSW 9 120464698 nonsense probably null
R4126:Myrip UTSW 9 120464698 nonsense probably null
R4128:Myrip UTSW 9 120464698 nonsense probably null
R4435:Myrip UTSW 9 120335614 start gained probably benign
R4599:Myrip UTSW 9 120464784 missense probably damaging 0.97
R5014:Myrip UTSW 9 120422468 missense probably damaging 1.00
R5665:Myrip UTSW 9 120461433 missense probably damaging 1.00
R5814:Myrip UTSW 9 120424668 missense probably benign 0.06
R5849:Myrip UTSW 9 120453693 missense probably damaging 0.99
R5986:Myrip UTSW 9 120461421 missense probably damaging 1.00
R6706:Myrip UTSW 9 120388293 missense possibly damaging 0.93
R7019:Myrip UTSW 9 120422507 missense probably damaging 1.00
R7291:Myrip UTSW 9 120417141 missense probably damaging 0.97
Z1177:Myrip UTSW 9 120432778 missense probably benign
Z1177:Myrip UTSW 9 120441481 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGAACTGGACGTCAATTTC -3'
(R):5'- CGTTGATGTTCTGGTCAAGCTC -3'

Sequencing Primer
(F):5'- TGGACGTCAATTTCAACCCTCAG -3'
(R):5'- TGTTCTGGTCAAGCTCAAGAGACAC -3'
Posted On2020-07-13