Incidental Mutation 'R8204:Myrip'
ID 635822
Institutional Source Beutler Lab
Gene Symbol Myrip
Ensembl Gene ENSMUSG00000041794
Gene Name myosin VIIA and Rab interacting protein
Synonyms A230081N12Rik, Slac2-c
MMRRC Submission 067627-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8204 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 120132996-120305167 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 120262045 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000046891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048121]
AlphaFold Q8K3I4
Predicted Effect probably null
Transcript: ENSMUST00000048121
SMART Domains Protein: ENSMUSP00000046891
Gene: ENSMUSG00000041794

DomainStartEndE-ValueType
Pfam:FYVE_2 8 125 3.8e-46 PFAM
Pfam:Rab_eff_C 152 856 N/A PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,057,606 (GRCm39) R731H probably benign Het
Arpp21 T A 9: 111,965,638 (GRCm39) Y408F noncoding transcript Het
Atr T C 9: 95,817,566 (GRCm39) S2086P Het
BC034090 C A 1: 155,117,488 (GRCm39) G210V probably damaging Het
Cdk6 A G 5: 3,394,461 (GRCm39) D32G probably damaging Het
Cep126 C T 9: 8,120,781 (GRCm39) E81K probably damaging Het
Cep20 T C 16: 14,118,070 (GRCm39) D150G probably benign Het
Clec4d T A 6: 123,242,323 (GRCm39) V25D probably damaging Het
Cox8a A G 19: 7,192,845 (GRCm39) I40T probably benign Het
Dlg5 A G 14: 24,210,320 (GRCm39) L792P probably damaging Het
Egln3 T C 12: 54,250,010 (GRCm39) Y113C probably benign Het
Exoc6b C T 6: 84,832,504 (GRCm39) V397M probably damaging Het
Fat2 A T 11: 55,175,436 (GRCm39) L1759Q probably benign Het
Flg2 T A 3: 93,110,074 (GRCm39) S701T unknown Het
Flvcr2 GTAGTGTATA GTA 12: 85,849,922 (GRCm39) probably null Het
Git1 G A 11: 77,396,161 (GRCm39) D551N probably benign Het
Gpr137 C T 19: 6,917,746 (GRCm39) A21T probably benign Het
Grk3 A G 5: 113,105,225 (GRCm39) F171L probably benign Het
Hk1 A G 10: 62,132,523 (GRCm39) F175S probably damaging Het
Hoxc13 A G 15: 102,835,795 (GRCm39) N308D probably damaging Het
Itga9 A G 9: 118,700,989 (GRCm39) N924S probably damaging Het
Katnip C T 7: 125,449,914 (GRCm39) R993C probably damaging Het
Klhl20 T C 1: 160,934,414 (GRCm39) M202V probably benign Het
Krtap19-9a C T 16: 88,720,996 (GRCm39) G37D noncoding transcript Het
Lancl2 C A 6: 57,714,701 (GRCm39) P440Q probably damaging Het
Lrba T C 3: 86,222,710 (GRCm39) I608T possibly damaging Het
Lrtm2 T A 6: 119,294,369 (GRCm39) E254V probably benign Het
Magi3 A T 3: 103,958,502 (GRCm39) C528S probably benign Het
Mast3 T C 8: 71,240,925 (GRCm39) D224G probably benign Het
Myl10 G C 5: 136,726,825 (GRCm39) V70L probably benign Het
Or4f54 A G 2: 111,123,485 (GRCm39) R291G probably damaging Het
Or5af2 A C 11: 58,707,885 (GRCm39) D17A probably benign Het
Plekhg6 C T 6: 125,340,461 (GRCm39) R633H probably damaging Het
Ppp1r7 T C 1: 93,292,733 (GRCm39) V344A possibly damaging Het
Ppp2r1a A G 17: 21,177,035 (GRCm39) E191G probably benign Het
Prkag2 T C 5: 25,074,125 (GRCm39) probably null Het
Pyroxd2 A T 19: 42,737,827 (GRCm39) V48E probably benign Het
Sacs T C 14: 61,450,397 (GRCm39) S4148P probably damaging Het
Sh3tc2 T C 18: 62,086,200 (GRCm39) F5S probably damaging Het
Skint8 T C 4: 111,796,090 (GRCm39) S255P probably benign Het
Tacc2 A T 7: 130,226,159 (GRCm39) Q948L probably damaging Het
Tcerg1 T A 18: 42,707,618 (GRCm39) L1046Q probably damaging Het
Tcof1 G C 18: 60,962,123 (GRCm39) A702G possibly damaging Het
Tfcp2 G T 15: 100,420,329 (GRCm39) Q169K possibly damaging Het
Tpp1 A T 7: 105,399,522 (GRCm39) L82Q probably damaging Het
Trpc7 A G 13: 56,931,609 (GRCm39) S697P probably benign Het
Vmn1r55 A T 7: 5,150,285 (GRCm39) I46N possibly damaging Het
Wdfy3 A G 5: 102,000,451 (GRCm39) V2973A probably benign Het
Xrcc1 T C 7: 24,271,709 (GRCm39) V564A possibly damaging Het
Other mutations in Myrip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01924:Myrip APN 9 120,217,330 (GRCm39) missense probably damaging 1.00
IGL02108:Myrip APN 9 120,296,631 (GRCm39) critical splice donor site probably null
IGL02406:Myrip APN 9 120,296,598 (GRCm39) missense probably benign
IGL02876:Myrip APN 9 120,261,740 (GRCm39) missense probably damaging 1.00
IGL03109:Myrip APN 9 120,282,790 (GRCm39) splice site probably null
IGL03258:Myrip APN 9 120,270,418 (GRCm39) missense probably benign 0.45
PIT4581001:Myrip UTSW 9 120,296,583 (GRCm39) missense probably damaging 0.98
R0485:Myrip UTSW 9 120,270,443 (GRCm39) missense probably benign 0.01
R0633:Myrip UTSW 9 120,217,302 (GRCm39) missense probably damaging 1.00
R1489:Myrip UTSW 9 120,261,595 (GRCm39) missense probably damaging 1.00
R1539:Myrip UTSW 9 120,253,689 (GRCm39) missense probably benign 0.00
R1708:Myrip UTSW 9 120,293,840 (GRCm39) missense possibly damaging 0.65
R1817:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1818:Myrip UTSW 9 120,217,228 (GRCm39) missense probably damaging 1.00
R1878:Myrip UTSW 9 120,253,721 (GRCm39) missense probably damaging 0.99
R2484:Myrip UTSW 9 120,253,685 (GRCm39) missense probably benign 0.00
R3237:Myrip UTSW 9 120,270,473 (GRCm39) missense possibly damaging 0.91
R3890:Myrip UTSW 9 120,251,324 (GRCm39) missense probably damaging 1.00
R3912:Myrip UTSW 9 120,261,682 (GRCm39) missense probably benign
R3919:Myrip UTSW 9 120,261,695 (GRCm39) missense probably damaging 1.00
R4125:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4126:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4128:Myrip UTSW 9 120,293,764 (GRCm39) nonsense probably null
R4435:Myrip UTSW 9 120,164,680 (GRCm39) start gained probably benign
R4599:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
R5014:Myrip UTSW 9 120,251,534 (GRCm39) missense probably damaging 1.00
R5665:Myrip UTSW 9 120,290,499 (GRCm39) missense probably damaging 1.00
R5814:Myrip UTSW 9 120,253,734 (GRCm39) missense probably benign 0.06
R5849:Myrip UTSW 9 120,282,759 (GRCm39) missense probably damaging 0.99
R5986:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R6706:Myrip UTSW 9 120,217,359 (GRCm39) missense possibly damaging 0.93
R7019:Myrip UTSW 9 120,251,573 (GRCm39) missense probably damaging 1.00
R7291:Myrip UTSW 9 120,246,207 (GRCm39) missense probably damaging 0.97
R8557:Myrip UTSW 9 120,246,252 (GRCm39) missense probably benign 0.32
R8853:Myrip UTSW 9 120,290,487 (GRCm39) missense probably damaging 1.00
R8911:Myrip UTSW 9 120,270,484 (GRCm39) missense possibly damaging 0.94
R9106:Myrip UTSW 9 120,261,544 (GRCm39) missense probably benign 0.37
R9225:Myrip UTSW 9 120,293,850 (GRCm39) missense probably damaging 0.97
Z1177:Myrip UTSW 9 120,270,547 (GRCm39) missense probably damaging 1.00
Z1177:Myrip UTSW 9 120,261,844 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GGGAGAACTGGACGTCAATTTC -3'
(R):5'- CGTTGATGTTCTGGTCAAGCTC -3'

Sequencing Primer
(F):5'- TGGACGTCAATTTCAACCCTCAG -3'
(R):5'- TGTTCTGGTCAAGCTCAAGAGACAC -3'
Posted On 2020-07-13