Incidental Mutation 'R8204:Olfr313'
ID635825
Institutional Source Beutler Lab
Gene Symbol Olfr313
Ensembl Gene ENSMUSG00000070438
Gene Nameolfactory receptor 313
SynonymsGA_x6K02T2NKPP-590035-589109, MOR222-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8204 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location58815000-58819450 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58817059 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 17 (D17A)
Ref Sequence ENSEMBL: ENSMUSP00000080852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082220]
Predicted Effect probably benign
Transcript: ENSMUST00000082220
AA Change: D17A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000080852
Gene: ENSMUSG00000070438
AA Change: D17A

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 217 4.5e-9 PFAM
Pfam:7tm_1 39 288 5.2e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933427D14Rik C T 11: 72,166,780 R731H probably benign Het
Adrbk2 A G 5: 112,957,359 F171L probably benign Het
Arpp21 T A 9: 112,136,570 Y408F noncoding transcript Het
Atr T C 9: 95,935,513 S2086P Het
BC034090 C A 1: 155,241,742 G210V probably damaging Het
Cdk6 A G 5: 3,344,461 D32G probably damaging Het
Cep126 C T 9: 8,120,780 E81K probably damaging Het
Clec4d T A 6: 123,265,364 V25D probably damaging Het
Cox8a A G 19: 7,215,480 I40T probably benign Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dlg5 A G 14: 24,160,252 L792P probably damaging Het
Egln3 T C 12: 54,203,224 Y113C probably benign Het
Exoc6b C T 6: 84,855,522 V397M probably damaging Het
Fat2 A T 11: 55,284,610 L1759Q probably benign Het
Flg2 T A 3: 93,202,767 S701T unknown Het
Fopnl T C 16: 14,300,206 D150G probably benign Het
Git1 G A 11: 77,505,335 D551N probably benign Het
Gpr137 C T 19: 6,940,378 A21T probably benign Het
Hk1 A G 10: 62,296,744 F175S probably damaging Het
Hoxc13 A G 15: 102,927,360 N308D probably damaging Het
Itga9 A G 9: 118,871,921 N924S probably damaging Het
Klhl20 T C 1: 161,106,844 M202V probably benign Het
Krtap19-9a C T 16: 88,924,108 G37D noncoding transcript Het
Lancl2 C A 6: 57,737,716 P440Q probably damaging Het
Lrba T C 3: 86,315,403 I608T possibly damaging Het
Lrtm2 T A 6: 119,317,408 E254V probably benign Het
Magi3 A T 3: 104,051,186 C528S probably benign Het
Mast3 T C 8: 70,788,281 D224G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myrip G A 9: 120,432,979 probably null Het
Olfr1278 A G 2: 111,293,140 R291G probably damaging Het
Plekhg6 C T 6: 125,363,498 R633H probably damaging Het
Ppp1r7 T C 1: 93,365,011 V344A possibly damaging Het
Ppp2r1a A G 17: 20,956,773 E191G probably benign Het
Prkag2 T C 5: 24,869,127 probably null Het
Pyroxd2 A T 19: 42,749,388 V48E probably benign Het
Sacs T C 14: 61,212,948 S4148P probably damaging Het
Sh3tc2 T C 18: 61,953,129 F5S probably damaging Het
Skint8 T C 4: 111,938,893 S255P probably benign Het
Tacc2 A T 7: 130,624,429 Q948L probably damaging Het
Tcerg1 T A 18: 42,574,553 L1046Q probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfcp2 G T 15: 100,522,448 Q169K possibly damaging Het
Tpp1 A T 7: 105,750,315 L82Q probably damaging Het
Trpc7 A G 13: 56,783,796 S697P probably benign Het
Vmn1r55 A T 7: 5,147,286 I46N possibly damaging Het
Wdfy3 A G 5: 101,852,585 V2973A probably benign Het
Xrcc1 T C 7: 24,572,284 V564A possibly damaging Het
Other mutations in Olfr313
AlleleSourceChrCoordTypePredicted EffectPPH Score
FR4548:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
FR4976:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
LCD18:Olfr313 UTSW 11 58817440 missense possibly damaging 0.80
R0269:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0617:Olfr313 UTSW 11 58817149 missense probably damaging 1.00
R0707:Olfr313 UTSW 11 58817751 missense probably damaging 1.00
R2917:Olfr313 UTSW 11 58817488 missense probably damaging 1.00
R3085:Olfr313 UTSW 11 58817727 missense probably damaging 1.00
R4245:Olfr313 UTSW 11 58817778 missense probably damaging 1.00
R4991:Olfr313 UTSW 11 58817718 missense probably damaging 1.00
R5188:Olfr313 UTSW 11 58817320 missense probably damaging 0.96
R6985:Olfr313 UTSW 11 58817113 missense probably damaging 0.98
R7076:Olfr313 UTSW 11 58817164 missense probably benign 0.17
R7253:Olfr313 UTSW 11 58817540 nonsense probably null
R7553:Olfr313 UTSW 11 58817060 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- ATAGCAGCCACACCTCTGTAGTC -3'
(R):5'- CTTGATAGGAGATGACCCCTGAG -3'

Sequencing Primer
(F):5'- ACCTCTGTAGTCAACGTGGAACTG -3'
(R):5'- TGAGGGATATCACCACTGCCTTG -3'
Posted On2020-07-13