Incidental Mutation 'R0723:Mettl13'
ID63585
Institutional Source Beutler Lab
Gene Symbol Mettl13
Ensembl Gene ENSMUSG00000026694
Gene Namemethyltransferase like 13
Synonyms5630401D24Rik
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.345) question?
Stock #R0723 (G1)
Quality Score165
Status Validated
Chromosome1
Chromosomal Location162532127-162548551 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162534430 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 648 (I648N)
Ref Sequence ENSEMBL: ENSMUSP00000028017 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028017] [ENSMUST00000159316] [ENSMUST00000159817] [ENSMUST00000176220]
Predicted Effect probably damaging
Transcript: ENSMUST00000028017
AA Change: I648N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028017
Gene: ENSMUSG00000026694
AA Change: I648N

DomainStartEndE-ValueType
Pfam:TPMT 13 172 1e-7 PFAM
Pfam:Ubie_methyltran 38 190 6.6e-7 PFAM
Pfam:Methyltransf_31 46 198 5.3e-13 PFAM
Pfam:Methyltransf_18 48 161 1.1e-10 PFAM
Pfam:Methyltransf_25 52 154 3.7e-9 PFAM
Pfam:Methyltransf_11 53 158 4.1e-16 PFAM
low complexity region 436 452 N/A INTRINSIC
Pfam:Spermine_synth 472 630 7.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159316
SMART Domains Protein: ENSMUSP00000135822
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Methyltransf_25 1 101 2.7e-10 PFAM
Pfam:Methyltransf_18 1 102 8e-11 PFAM
Pfam:Methyltransf_31 1 149 1.9e-12 PFAM
Pfam:Methyltransf_11 2 100 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159817
SMART Domains Protein: ENSMUSP00000124267
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:TPMT 13 144 4.6e-8 PFAM
Pfam:Methyltransf_31 46 195 3.5e-12 PFAM
Pfam:Methyltransf_18 48 160 5e-11 PFAM
Pfam:Methyltransf_25 52 154 1.1e-9 PFAM
Pfam:Methyltransf_11 53 158 6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176220
SMART Domains Protein: ENSMUSP00000135879
Gene: ENSMUSG00000026694

DomainStartEndE-ValueType
Pfam:Spermine_synth 73 239 1.8e-8 PFAM
Pfam:Methyltransf_18 126 234 1.3e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176689
Meta Mutation Damage Score 0.5858 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acbd5 T G 2: 23,069,596 V54G probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Mettl13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mettl13 APN 1 162535865 missense possibly damaging 0.74
IGL00589:Mettl13 APN 1 162542391 missense probably damaging 1.00
IGL01765:Mettl13 APN 1 162538953 missense probably benign
IGL02200:Mettl13 APN 1 162538823 intron probably benign
IGL02835:Mettl13 UTSW 1 162546016 missense probably damaging 0.97
R0055:Mettl13 UTSW 1 162546181 missense probably damaging 1.00
R0322:Mettl13 UTSW 1 162544176 splice site probably benign
R0390:Mettl13 UTSW 1 162538889 missense possibly damaging 0.51
R0423:Mettl13 UTSW 1 162544385 missense probably damaging 1.00
R1472:Mettl13 UTSW 1 162537167 missense possibly damaging 0.95
R2429:Mettl13 UTSW 1 162546325 nonsense probably null
R3755:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R3756:Mettl13 UTSW 1 162544220 missense probably damaging 0.97
R4058:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4059:Mettl13 UTSW 1 162546186 missense probably damaging 1.00
R4087:Mettl13 UTSW 1 162548202 missense possibly damaging 0.53
R4885:Mettl13 UTSW 1 162537268 missense probably damaging 0.99
R4974:Mettl13 UTSW 1 162537220 missense probably damaging 0.99
R5070:Mettl13 UTSW 1 162545899 missense possibly damaging 0.47
R5447:Mettl13 UTSW 1 162535880 missense probably benign 0.01
R5702:Mettl13 UTSW 1 162545980 missense probably benign 0.00
R6137:Mettl13 UTSW 1 162535886 missense probably benign 0.09
R6570:Mettl13 UTSW 1 162544286 missense probably damaging 0.99
R6754:Mettl13 UTSW 1 162548123 missense probably damaging 1.00
R7340:Mettl13 UTSW 1 162538978 missense probably benign 0.00
R7386:Mettl13 UTSW 1 162548154 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACAGAAAGCTGAGTTGCCTG -3'
(R):5'- ACTGTGGAAACCATCAAGGCTGAAG -3'

Sequencing Primer
(F):5'- CTGAGTTGCCTGGCCCC -3'
(R):5'- CCATCAAGGCTGAAGTTTTCTTACAC -3'
Posted On2013-07-30