Incidental Mutation 'R8205:Mex3a'
ID 635852
Institutional Source Beutler Lab
Gene Symbol Mex3a
Ensembl Gene ENSMUSG00000074480
Gene Name mex3 RNA binding family member A
Synonyms 2700083E18Rik, Rkhd4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.178) question?
Stock # R8205 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 88532395-88541396 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 88536852 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 412 (S412P)
Ref Sequence ENSEMBL: ENSMUSP00000134222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172699]
AlphaFold G3UYU0
Predicted Effect possibly damaging
Transcript: ENSMUST00000172699
AA Change: S412P

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134222
Gene: ENSMUSG00000074480
AA Change: S412P

DomainStartEndE-ValueType
low complexity region 14 24 N/A INTRINSIC
low complexity region 37 51 N/A INTRINSIC
low complexity region 53 110 N/A INTRINSIC
KH 130 198 3.35e-9 SMART
KH 222 289 4.59e-16 SMART
low complexity region 406 415 N/A INTRINSIC
RING 469 508 1.39e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Cap2 G A 13: 46,615,263 V182M probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Fgd3 T C 13: 49,296,347 D142G probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Ndufaf7 G A 17: 78,947,032 C418Y probably benign Het
Nlrp4a A G 7: 26,450,794 S609G probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Odf2l A G 3: 145,150,734 probably benign Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Sacm1l G A 9: 123,586,659 probably null Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Vmn2r98 T C 17: 19,081,163 V809A probably damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Mex3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01581:Mex3a APN 3 88536364 missense probably damaging 1.00
IGL02930:Mex3a APN 3 88536225 missense probably benign 0.21
IGL03000:Mex3a APN 3 88536295 missense probably damaging 1.00
IGL03357:Mex3a APN 3 88536246 missense probably benign 0.06
R0143:Mex3a UTSW 3 88536255 missense probably benign 0.04
R1109:Mex3a UTSW 3 88536660 missense possibly damaging 0.90
R1700:Mex3a UTSW 3 88536375 missense probably damaging 1.00
R2312:Mex3a UTSW 3 88536478 missense probably damaging 1.00
R5070:Mex3a UTSW 3 88536387 missense probably damaging 1.00
R6838:Mex3a UTSW 3 88536777 missense probably benign 0.04
R8006:Mex3a UTSW 3 88537086 missense probably damaging 1.00
R8111:Mex3a UTSW 3 88536757 missense probably benign 0.18
R9288:Mex3a UTSW 3 88536151 missense possibly damaging 0.95
R9386:Mex3a UTSW 3 88536198 missense possibly damaging 0.55
R9415:Mex3a UTSW 3 88537173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCACCTTCAGGCAGAACAG -3'
(R):5'- AAAAGGTTGTGTCCACAGGG -3'

Sequencing Primer
(F):5'- CGTGGACTCGGCCTTTGAG -3'
(R):5'- AGGGCTGCTGTCACTTCAC -3'
Posted On 2020-07-13