Incidental Mutation 'R8205:Steap4'
ID 635859
Institutional Source Beutler Lab
Gene Symbol Steap4
Ensembl Gene ENSMUSG00000012428
Gene Name STEAP family member 4
Synonyms Tnfaip9, Tiarp
MMRRC Submission 067628-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.089) question?
Stock # R8205 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 8010472-8032213 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 8026795 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 253 (I253F)
Ref Sequence ENSEMBL: ENSMUSP00000111081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115421]
AlphaFold Q923B6
Predicted Effect possibly damaging
Transcript: ENSMUST00000115421
AA Change: I253F

PolyPhen 2 Score 0.655 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: I253F

DomainStartEndE-ValueType
Pfam:F420_oxidored 21 107 2.3e-16 PFAM
transmembrane domain 203 225 N/A INTRINSIC
Pfam:Ferric_reduct 247 395 2.6e-14 PFAM
transmembrane domain 416 438 N/A INTRINSIC
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 41,278,080 (GRCm39) V157A probably benign Het
Adamtsl1 A G 4: 86,117,650 (GRCm39) *204W probably null Het
Add2 A G 6: 86,063,899 (GRCm39) E66G probably damaging Het
Adgrd1 A G 5: 129,192,175 (GRCm39) T114A possibly damaging Het
Aldh7a1 A T 18: 56,678,070 (GRCm39) I247N probably damaging Het
Ankrd13d A T 19: 4,331,009 (GRCm39) M166K probably damaging Het
Brd7 A G 8: 89,070,243 (GRCm39) F388L probably damaging Het
Cap2 G A 13: 46,768,739 (GRCm39) V182M probably damaging Het
Col22a1 A T 15: 71,732,918 (GRCm39) V1100E unknown Het
Cracdl T C 1: 37,664,047 (GRCm39) D617G probably benign Het
Crisp2 T C 17: 41,095,969 (GRCm39) E63G possibly damaging Het
Dst T G 1: 34,253,685 (GRCm39) W2304G probably damaging Het
Eif2a A C 3: 58,456,156 (GRCm39) N385T probably damaging Het
Eif4ebp2 A T 10: 61,270,704 (GRCm39) H108Q probably benign Het
Fgd3 T C 13: 49,449,823 (GRCm39) D142G probably benign Het
Gbp8 T A 5: 105,198,846 (GRCm39) H23L probably benign Het
Glt1d1 A G 5: 127,768,080 (GRCm39) E229G probably benign Het
Gpatch8 T C 11: 102,371,213 (GRCm39) D775G unknown Het
Heatr1 T C 13: 12,430,928 (GRCm39) Y1008H probably benign Het
Heatr5a T A 12: 52,005,792 (GRCm39) N61I probably benign Het
Hydin A T 8: 111,319,270 (GRCm39) H4391L possibly damaging Het
Ifi206 T C 1: 173,309,450 (GRCm39) E182G Het
Mbtps1 A G 8: 120,247,077 (GRCm39) S789P probably damaging Het
Mex3a T C 3: 88,444,159 (GRCm39) S412P possibly damaging Het
Msantd5f1 G A 4: 73,605,542 (GRCm39) V318I possibly damaging Het
Mup2 T A 4: 60,137,659 (GRCm39) D128V probably benign Het
Ndufaf7 G A 17: 79,254,461 (GRCm39) C418Y probably benign Het
Nlrp4a A G 7: 26,150,219 (GRCm39) S609G probably benign Het
Obscn T A 11: 58,898,697 (GRCm39) Y6554F unknown Het
Odf2l A G 3: 144,856,495 (GRCm39) probably benign Het
Or14j2 A T 17: 37,885,892 (GRCm39) C141S probably damaging Het
Or1o11 T C 17: 37,757,180 (GRCm39) V245A probably damaging Het
Or4c104 A T 2: 88,587,016 (GRCm39) M1K probably null Het
Plod2 G T 9: 92,424,371 (GRCm39) probably benign Het
Ptgfr A G 3: 151,541,418 (GRCm39) V30A probably benign Het
Pxdn T G 12: 30,056,566 (GRCm39) L1259R probably damaging Het
Rnf6 A G 5: 146,147,714 (GRCm39) S435P probably damaging Het
Sacm1l G A 9: 123,415,724 (GRCm39) probably null Het
Scgb2b26 T C 7: 33,643,833 (GRCm39) T36A probably benign Het
Slc1a7 A G 4: 107,865,508 (GRCm39) N332S probably benign Het
Slfn5 T C 11: 82,851,544 (GRCm39) F614L probably benign Het
Smad7 C A 18: 75,527,119 (GRCm39) Q322K probably damaging Het
Smap1 T C 1: 23,888,507 (GRCm39) T253A probably benign Het
Socs5 G T 17: 87,441,138 (GRCm39) R26L probably benign Het
Tacc1 G A 8: 25,672,803 (GRCm39) H142Y probably benign Het
Tent5c A G 3: 100,380,138 (GRCm39) F206S probably benign Het
Tmem117 G A 15: 94,992,679 (GRCm39) M446I probably benign Het
Trav7-6 G A 14: 53,954,550 (GRCm39) D47N probably benign Het
Trim2 C A 3: 84,100,646 (GRCm39) A162S probably damaging Het
Ttc28 A G 5: 111,373,596 (GRCm39) I1011V possibly damaging Het
Vmn2r98 T C 17: 19,301,425 (GRCm39) V809A probably damaging Het
Wfikkn1 T A 17: 26,097,071 (GRCm39) T418S probably benign Het
Zbtb41 T A 1: 139,356,919 (GRCm39) D391E possibly damaging Het
Zfp109 G A 7: 23,928,635 (GRCm39) S266F probably damaging Het
Other mutations in Steap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Steap4 APN 5 8,026,979 (GRCm39) missense probably damaging 1.00
IGL00827:Steap4 APN 5 8,026,712 (GRCm39) missense probably damaging 1.00
IGL01481:Steap4 APN 5 8,026,858 (GRCm39) missense probably damaging 0.98
IGL02378:Steap4 APN 5 8,026,741 (GRCm39) missense probably benign 0.00
IGL03058:Steap4 APN 5 8,025,664 (GRCm39) missense probably benign 0.00
PIT4362001:Steap4 UTSW 5 8,030,337 (GRCm39) missense probably benign 0.03
R0329:Steap4 UTSW 5 8,025,829 (GRCm39) missense possibly damaging 0.92
R0546:Steap4 UTSW 5 8,025,870 (GRCm39) missense probably damaging 0.99
R0637:Steap4 UTSW 5 8,028,398 (GRCm39) splice site probably benign
R0638:Steap4 UTSW 5 8,027,030 (GRCm39) splice site probably benign
R0651:Steap4 UTSW 5 8,030,348 (GRCm39) nonsense probably null
R0881:Steap4 UTSW 5 8,030,388 (GRCm39) missense probably benign
R1167:Steap4 UTSW 5 8,026,520 (GRCm39) missense probably benign 0.34
R1543:Steap4 UTSW 5 8,025,902 (GRCm39) splice site probably benign
R1889:Steap4 UTSW 5 8,025,892 (GRCm39) missense probably damaging 1.00
R3803:Steap4 UTSW 5 8,026,979 (GRCm39) missense probably damaging 1.00
R3811:Steap4 UTSW 5 8,027,017 (GRCm39) missense probably benign 0.18
R3885:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R3887:Steap4 UTSW 5 8,030,494 (GRCm39) missense probably damaging 1.00
R4051:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R4208:Steap4 UTSW 5 8,030,404 (GRCm39) missense probably damaging 1.00
R5016:Steap4 UTSW 5 8,026,699 (GRCm39) nonsense probably null
R5302:Steap4 UTSW 5 8,025,547 (GRCm39) nonsense probably null
R5951:Steap4 UTSW 5 8,025,769 (GRCm39) missense probably benign 0.00
R6136:Steap4 UTSW 5 8,028,562 (GRCm39) missense probably damaging 0.99
R6527:Steap4 UTSW 5 8,028,502 (GRCm39) missense probably damaging 0.99
R6631:Steap4 UTSW 5 8,026,995 (GRCm39) nonsense probably null
R6964:Steap4 UTSW 5 8,025,568 (GRCm39) missense probably damaging 1.00
R7055:Steap4 UTSW 5 8,026,858 (GRCm39) missense probably damaging 1.00
R7408:Steap4 UTSW 5 8,028,453 (GRCm39) missense probably benign 0.07
R7692:Steap4 UTSW 5 8,026,976 (GRCm39) missense probably benign 0.32
R8861:Steap4 UTSW 5 8,025,672 (GRCm39) missense probably benign 0.00
R9287:Steap4 UTSW 5 8,026,683 (GRCm39) missense probably benign 0.05
R9423:Steap4 UTSW 5 8,026,720 (GRCm39) missense probably damaging 0.99
R9504:Steap4 UTSW 5 8,030,538 (GRCm39) missense probably benign 0.00
R9531:Steap4 UTSW 5 8,028,424 (GRCm39) missense probably benign 0.20
R9566:Steap4 UTSW 5 8,025,646 (GRCm39) missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- CCTCTGCAACTATTTCCAATGTGG -3'
(R):5'- AATGGTTGCATTTCTCAGCCTC -3'

Sequencing Primer
(F):5'- CCAATGTGGAGGTTTCCTTTC -3'
(R):5'- CTCCATCGAACATAGTAACGGATAGG -3'
Posted On 2020-07-13