Incidental Mutation 'R8205:Nlrp4a'
ID635867
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene NameNLR family, pyrin domain containing 4A
SynonymsE330028A19Rik, Nalp-eta, Nalp4a
MMRRC Submission
Accession Numbers

Genbank: NM_172896; MGI: 2443697

Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R8205 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location26435113-26476142 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26450794 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 609 (S609G)
Ref Sequence ENSEMBL: ENSMUSP00000066841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
Predicted Effect probably benign
Transcript: ENSMUST00000068767
AA Change: S609G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: S609G

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119386
AA Change: S609G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: S609G

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146907
AA Change: S609G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Cap2 G A 13: 46,615,263 V182M probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Fgd3 T C 13: 49,296,347 D142G probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mex3a T C 3: 88,536,852 S412P possibly damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Ndufaf7 G A 17: 78,947,032 C418Y probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Odf2l A G 3: 145,150,734 probably benign Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Sacm1l G A 9: 123,586,659 probably null Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Vmn2r98 T C 17: 19,081,163 V809A probably damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26449985 missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26457048 missense probably benign
IGL01081:Nlrp4a APN 7 26449829 missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26454067 missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26449969 missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26475097 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26459692 missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02197:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26449278 missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26449713 missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26459815 splice site probably benign
IGL02960:Nlrp4a APN 7 26449730 missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26449509 missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26464190 missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26444341 missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26450372 missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26462516 missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26449232 splice site probably benign
R0466:Nlrp4a UTSW 7 26462620 splice site probably benign
R0544:Nlrp4a UTSW 7 26457130 missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26453467 missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26444435 missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26464197 frame shift probably null
R1655:Nlrp4a UTSW 7 26449651 missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26450534 missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26450186 missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26450153 missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26453397 missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26449424 missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26449894 missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26464198 missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26449230 splice site probably null
R3812:Nlrp4a UTSW 7 26449693 missense probably benign
R4114:Nlrp4a UTSW 7 26449940 missense probably damaging 1.00
R4664:Nlrp4a UTSW 7 26449518 nonsense probably null
R4676:Nlrp4a UTSW 7 26450229 missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26464108 missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26475090 missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26450808 missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26450419 missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26462480 missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26450492 missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26459811 critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26454153 missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26457030 missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26450164 missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26453389 missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26449396 missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26449833 missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26450438 missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26444273 missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26449538 missense not run
R7548:Nlrp4a UTSW 7 26450179 missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26449245 critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26449562 missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26449265 missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26450057 missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26450586 missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26464146 missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26450645 missense possibly damaging 0.51
R8477:Nlrp4a UTSW 7 26459794 missense probably benign
R8704:Nlrp4a UTSW 7 26457138 missense probably benign 0.02
T0975:Nlrp4a UTSW 7 26449637 missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26444342 missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26454163 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GATGGCATGAAGCTGTTTTACTGTC -3'
(R):5'- TGTCCCTAATGTGCACCACC -3'

Sequencing Primer
(F):5'- CTGTTTGAGATGGACGATGACACC -3'
(R):5'- GCACACACAATCTGTTGAGTTTGC -3'
Posted On2020-07-13