Incidental Mutation 'R0723:Acbd5'
ID63587
Institutional Source Beutler Lab
Gene Symbol Acbd5
Ensembl Gene ENSMUSG00000026781
Gene Nameacyl-Coenzyme A binding domain containing 5
Synonyms
MMRRC Submission 038905-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0723 (G1)
Quality Score155
Status Validated
Chromosome2
Chromosomal Location23068167-23115558 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 23069596 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 54 (V54G)
Ref Sequence ENSEMBL: ENSMUSP00000154043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028121] [ENSMUST00000114523] [ENSMUST00000114526] [ENSMUST00000114529] [ENSMUST00000144088] [ENSMUST00000155602] [ENSMUST00000226571] [ENSMUST00000227663] [ENSMUST00000227809] [ENSMUST00000228050]
Predicted Effect probably damaging
Transcript: ENSMUST00000028121
AA Change: V18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028121
Gene: ENSMUSG00000026781
AA Change: V18G

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 392 414 N/A INTRINSIC
transmembrane domain 442 464 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114523
AA Change: V18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110169
Gene: ENSMUSG00000026781
AA Change: V18G

DomainStartEndE-ValueType
Pfam:ACBP 8 96 2.4e-35 PFAM
low complexity region 117 130 N/A INTRINSIC
coiled coil region 152 179 N/A INTRINSIC
low complexity region 208 220 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
coiled coil region 393 415 N/A INTRINSIC
transmembrane domain 443 465 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114526
AA Change: V54G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110172
Gene: ENSMUSG00000026781
AA Change: V54G

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 44 132 4.7e-35 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 428 450 N/A INTRINSIC
transmembrane domain 478 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114529
AA Change: V54G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110175
Gene: ENSMUSG00000026781
AA Change: V54G

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
Pfam:ACBP 45 129 4.9e-30 PFAM
low complexity region 153 166 N/A INTRINSIC
coiled coil region 188 215 N/A INTRINSIC
low complexity region 244 256 N/A INTRINSIC
low complexity region 346 361 N/A INTRINSIC
coiled coil region 429 451 N/A INTRINSIC
transmembrane domain 479 501 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000144088
AA Change: V18G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000121395
Gene: ENSMUSG00000026781
AA Change: V18G

DomainStartEndE-ValueType
Pfam:ACBP 8 52 4.4e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155602
AA Change: V18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117325
Gene: ENSMUSG00000026781
AA Change: V18G

DomainStartEndE-ValueType
Pfam:ACBP 8 96 3.5e-36 PFAM
low complexity region 117 130 N/A INTRINSIC
low complexity region 146 157 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226571
AA Change: V54G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000227663
AA Change: V18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227809
AA Change: V18G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000228050
AA Change: V54G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228778
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228856
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228891
Meta Mutation Damage Score 0.8237 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the acyl-Coenzyme A binding protein family, known to function in the transport and distribution of long chain acyl-Coenzyme A in cells. This gene may play a role in the differentiation of megakaryocytes and formation of platelets. A related protein in yeast is involved in autophagy of peroxisomes. A mutation in this gene has been associated with autosomal dominant thrombocytopenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T A 4: 42,971,691 N341K probably damaging Het
4930433I11Rik A T 7: 40,993,056 T141S probably benign Het
4931423N10Rik T C 2: 23,256,924 probably benign Het
8030411F24Rik T C 2: 148,783,362 I72T probably damaging Het
Acin1 A T 14: 54,665,451 S255T probably damaging Het
Adcy2 A G 13: 68,999,129 L56P probably damaging Het
Akap6 G T 12: 53,141,902 C2033F probably damaging Het
Ano5 A G 7: 51,587,758 I777V probably benign Het
Arhgef28 A G 13: 97,939,479 V1349A probably benign Het
Bank1 T C 3: 136,054,403 probably null Het
C2cd5 T C 6: 143,041,555 probably benign Het
Cadps2 A G 6: 23,287,698 V1161A probably damaging Het
Car8 A T 4: 8,169,703 D268E probably benign Het
Ckap5 T A 2: 91,555,331 S175T probably damaging Het
Clk4 T A 11: 51,275,493 Y67* probably null Het
Copg2 T C 6: 30,815,982 I473V possibly damaging Het
Cyp2s1 C T 7: 25,809,548 V43I probably benign Het
Ddx54 A G 5: 120,623,638 D493G probably benign Het
Efemp2 T C 19: 5,480,050 S140P probably damaging Het
Fam214a G A 9: 75,009,451 G444E probably damaging Het
Fat1 C A 8: 45,026,749 T2944K probably damaging Het
Fgfr1 T A 8: 25,557,768 D43E probably damaging Het
Fry G A 5: 150,496,360 A996T probably damaging Het
Fyb2 G A 4: 105,015,866 V784I probably benign Het
Gm6507 T A 6: 89,185,162 noncoding transcript Het
Gm7964 T C 7: 83,756,166 noncoding transcript Het
Gucy2c T C 6: 136,727,801 probably null Het
Hdac10 A T 15: 89,126,418 L259Q probably damaging Het
Hoxd9 A T 2: 74,698,828 D258V probably damaging Het
Hs3st3b1 T C 11: 63,921,575 T105A probably benign Het
Hsd17b7 A G 1: 169,956,026 L271P probably damaging Het
Ifnlr1 T A 4: 135,701,213 probably benign Het
Kif22 A T 7: 127,033,906 M121K probably damaging Het
Kl G A 5: 150,953,101 D129N probably damaging Het
Mettl13 A T 1: 162,534,430 I648N probably damaging Het
Mlh1 C T 9: 111,271,472 R18H probably damaging Het
Mtmr14 T C 6: 113,270,512 probably benign Het
Myo15 C A 11: 60,478,977 N854K possibly damaging Het
Myo1h T C 5: 114,319,680 I84T probably benign Het
Myo9a A T 9: 59,871,100 S1380C probably benign Het
Myof A G 19: 37,981,260 V318A probably damaging Het
N4bp2l2 A G 5: 150,662,432 S28P probably damaging Het
Narfl G A 17: 25,781,821 V406M probably damaging Het
Nbr1 C T 11: 101,576,319 Q570* probably null Het
Nhp2 C T 11: 51,619,923 Q36* probably null Het
Olfr23 T G 11: 73,940,270 V8G probably benign Het
Olfr884 G T 9: 38,047,827 V202L probably benign Het
Poc1b T A 10: 99,129,595 W129R probably damaging Het
Rapgef2 C T 3: 79,079,174 E1018K probably benign Het
Rgs12 T C 5: 35,024,366 probably benign Het
Rufy2 G A 10: 62,998,094 V280I probably benign Het
Snx2 A G 18: 53,210,372 I281V probably benign Het
Spag5 C A 11: 78,319,584 probably benign Het
Stxbp5 A T 10: 9,768,873 I961N probably damaging Het
Tet2 T C 3: 133,467,284 E1739G probably benign Het
Tmod2 A G 9: 75,595,055 F50S possibly damaging Het
Tnfsf13b T G 8: 10,007,166 probably null Het
Ttn T C 2: 76,786,335 K16525E possibly damaging Het
Txnrd2 T C 16: 18,440,879 probably benign Het
Ubr1 A T 2: 120,881,101 Y1437* probably null Het
Vwf C A 6: 125,566,262 D170E probably benign Het
Wdr95 C G 5: 149,574,048 I230M probably damaging Het
Xirp2 C T 2: 67,512,215 S1600F probably damaging Het
Zfp12 A G 5: 143,244,883 K322E probably damaging Het
Other mutations in Acbd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01595:Acbd5 APN 2 23078169 missense probably damaging 1.00
IGL02343:Acbd5 APN 2 23087495 missense possibly damaging 0.89
IGL03087:Acbd5 APN 2 23089710 missense probably benign
R1428:Acbd5 UTSW 2 23099721 missense probably damaging 0.99
R1610:Acbd5 UTSW 2 23090551 missense probably damaging 1.00
R1623:Acbd5 UTSW 2 23094344 missense probably damaging 1.00
R2918:Acbd5 UTSW 2 23099567 missense probably benign 0.00
R4736:Acbd5 UTSW 2 23099584 missense probably damaging 0.96
R5369:Acbd5 UTSW 2 23112510 missense probably damaging 0.96
R6207:Acbd5 UTSW 2 23069478 missense possibly damaging 0.58
R6599:Acbd5 UTSW 2 23069080 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CGGTGTTCAGTTTCATGCAGGCTC -3'
(R):5'- AGTTAGGTAGCACCAGACATCCCTC -3'

Sequencing Primer
(F):5'- ATGCAGGCTCTTGGGGAAG -3'
(R):5'- TTTGGCCTCAAAAATCAGCGG -3'
Posted On2013-07-30