Incidental Mutation 'R8205:Cap2'
ID635882
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene NameCAP, adenylate cyclase-associated protein, 2 (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R8205 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location46501848-46650281 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46615263 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 182 (V182M)
Ref Sequence ENSEMBL: ENSMUSP00000021802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341]
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: V182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: V182M

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Fgd3 T C 13: 49,296,347 D142G probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mex3a T C 3: 88,536,852 S412P possibly damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Ndufaf7 G A 17: 78,947,032 C418Y probably benign Het
Nlrp4a A G 7: 26,450,794 S609G probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Odf2l A G 3: 145,150,734 probably benign Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Sacm1l G A 9: 123,586,659 probably null Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Vmn2r98 T C 17: 19,081,163 V809A probably damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46639949 splice site probably benign
IGL01927:Cap2 APN 13 46635633 missense probably benign 0.03
IGL02213:Cap2 APN 13 46635611 splice site probably benign
IGL02511:Cap2 APN 13 46531022 start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46525492 missense probably benign 0.00
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0063:Cap2 UTSW 13 46638032 splice site probably benign
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0234:Cap2 UTSW 13 46638022 critical splice donor site probably null
R0385:Cap2 UTSW 13 46560547 missense probably damaging 1.00
R0387:Cap2 UTSW 13 46560516 missense probably damaging 0.99
R0712:Cap2 UTSW 13 46615361 splice site probably null
R1489:Cap2 UTSW 13 46609635 missense probably damaging 1.00
R1666:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1668:Cap2 UTSW 13 46615323 missense probably damaging 0.98
R1676:Cap2 UTSW 13 46637859 missense probably damaging 1.00
R1756:Cap2 UTSW 13 46531013 missense probably benign 0.11
R1822:Cap2 UTSW 13 46615347 missense probably benign 0.03
R1867:Cap2 UTSW 13 46640079 missense probably damaging 1.00
R1972:Cap2 UTSW 13 46637899 missense probably damaging 0.98
R1990:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46637881 missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46560502 critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46639841 missense probably benign 0.20
R4024:Cap2 UTSW 13 46637841 splice site probably benign
R4554:Cap2 UTSW 13 46635774 missense probably damaging 1.00
R4748:Cap2 UTSW 13 46639826 missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46610110 missense probably damaging 0.99
R4876:Cap2 UTSW 13 46531021 start codon destroyed probably null
R4902:Cap2 UTSW 13 46531025 missense probably damaging 0.99
R5320:Cap2 UTSW 13 46648364 makesense probably null
R5666:Cap2 UTSW 13 46531083 splice site probably null
R5670:Cap2 UTSW 13 46531083 splice site probably null
R6086:Cap2 UTSW 13 46635712 missense probably damaging 1.00
R6728:Cap2 UTSW 13 46639859 missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46646625 missense probably damaging 1.00
R7785:Cap2 UTSW 13 46635748 missense probably benign
R7889:Cap2 UTSW 13 46646575 missense probably damaging 0.99
R8065:Cap2 UTSW 13 46637861 missense probably damaging 1.00
R8425:Cap2 UTSW 13 46609732 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CACCATCACTAGGTATGGCAC -3'
(R):5'- TTTCTATGGCCACCCGGGATAC -3'

Sequencing Primer
(F):5'- GTCTGTCTAGACCCAAAGTTGG -3'
(R):5'- GGGATACACATCTTCACAAGTGTC -3'
Posted On2020-07-13