Incidental Mutation 'R8205:Cap2'
ID 635882
Institutional Source Beutler Lab
Gene Symbol Cap2
Ensembl Gene ENSMUSG00000021373
Gene Name cyclase associated actin cytoskeleton regulatory protein 2
Synonyms 2810452G09Rik
MMRRC Submission 067628-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R8205 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 46655379-46803757 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 46768739 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 182 (V182M)
Ref Sequence ENSEMBL: ENSMUSP00000021802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021802] [ENSMUST00000119341]
AlphaFold Q9CYT6
Predicted Effect probably damaging
Transcript: ENSMUST00000021802
AA Change: V182M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021802
Gene: ENSMUSG00000021373
AA Change: V182M

DomainStartEndE-ValueType
Pfam:CAP_N 5 301 2.6e-117 PFAM
CARP 358 395 1.06e-10 SMART
CARP 396 433 1.12e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119341
SMART Domains Protein: ENSMUSP00000112952
Gene: ENSMUSG00000021373

DomainStartEndE-ValueType
Pfam:CAP_N 4 105 1.8e-25 PFAM
Pfam:CAP_N 99 198 8.2e-29 PFAM
CARP 246 283 1.06e-10 SMART
CARP 284 321 1.12e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by its similarity to the gene for human adenylyl cyclase-associated protein. The function of the protein encoded by this gene is unknown. However, the protein appears to be able to interact with adenylyl cyclase-associated protein and actin. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are smaller, prone to eye infections and show microphthalmia, cardiac conduction defects and dilated cardiomyopathy, predominantly in males. Males are underrepresented at weaning and ~70% die suddenly by 12 weeks of age, whereas females survive at nearly expected levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam39 T C 8: 41,278,080 (GRCm39) V157A probably benign Het
Adamtsl1 A G 4: 86,117,650 (GRCm39) *204W probably null Het
Add2 A G 6: 86,063,899 (GRCm39) E66G probably damaging Het
Adgrd1 A G 5: 129,192,175 (GRCm39) T114A possibly damaging Het
Aldh7a1 A T 18: 56,678,070 (GRCm39) I247N probably damaging Het
Ankrd13d A T 19: 4,331,009 (GRCm39) M166K probably damaging Het
Brd7 A G 8: 89,070,243 (GRCm39) F388L probably damaging Het
Col22a1 A T 15: 71,732,918 (GRCm39) V1100E unknown Het
Cracdl T C 1: 37,664,047 (GRCm39) D617G probably benign Het
Crisp2 T C 17: 41,095,969 (GRCm39) E63G possibly damaging Het
Dst T G 1: 34,253,685 (GRCm39) W2304G probably damaging Het
Eif2a A C 3: 58,456,156 (GRCm39) N385T probably damaging Het
Eif4ebp2 A T 10: 61,270,704 (GRCm39) H108Q probably benign Het
Fgd3 T C 13: 49,449,823 (GRCm39) D142G probably benign Het
Gbp8 T A 5: 105,198,846 (GRCm39) H23L probably benign Het
Glt1d1 A G 5: 127,768,080 (GRCm39) E229G probably benign Het
Gpatch8 T C 11: 102,371,213 (GRCm39) D775G unknown Het
Heatr1 T C 13: 12,430,928 (GRCm39) Y1008H probably benign Het
Heatr5a T A 12: 52,005,792 (GRCm39) N61I probably benign Het
Hydin A T 8: 111,319,270 (GRCm39) H4391L possibly damaging Het
Ifi206 T C 1: 173,309,450 (GRCm39) E182G Het
Mbtps1 A G 8: 120,247,077 (GRCm39) S789P probably damaging Het
Mex3a T C 3: 88,444,159 (GRCm39) S412P possibly damaging Het
Msantd5f1 G A 4: 73,605,542 (GRCm39) V318I possibly damaging Het
Mup2 T A 4: 60,137,659 (GRCm39) D128V probably benign Het
Ndufaf7 G A 17: 79,254,461 (GRCm39) C418Y probably benign Het
Nlrp4a A G 7: 26,150,219 (GRCm39) S609G probably benign Het
Obscn T A 11: 58,898,697 (GRCm39) Y6554F unknown Het
Odf2l A G 3: 144,856,495 (GRCm39) probably benign Het
Or14j2 A T 17: 37,885,892 (GRCm39) C141S probably damaging Het
Or1o11 T C 17: 37,757,180 (GRCm39) V245A probably damaging Het
Or4c104 A T 2: 88,587,016 (GRCm39) M1K probably null Het
Plod2 G T 9: 92,424,371 (GRCm39) probably benign Het
Ptgfr A G 3: 151,541,418 (GRCm39) V30A probably benign Het
Pxdn T G 12: 30,056,566 (GRCm39) L1259R probably damaging Het
Rnf6 A G 5: 146,147,714 (GRCm39) S435P probably damaging Het
Sacm1l G A 9: 123,415,724 (GRCm39) probably null Het
Scgb2b26 T C 7: 33,643,833 (GRCm39) T36A probably benign Het
Slc1a7 A G 4: 107,865,508 (GRCm39) N332S probably benign Het
Slfn5 T C 11: 82,851,544 (GRCm39) F614L probably benign Het
Smad7 C A 18: 75,527,119 (GRCm39) Q322K probably damaging Het
Smap1 T C 1: 23,888,507 (GRCm39) T253A probably benign Het
Socs5 G T 17: 87,441,138 (GRCm39) R26L probably benign Het
Steap4 A T 5: 8,026,795 (GRCm39) I253F possibly damaging Het
Tacc1 G A 8: 25,672,803 (GRCm39) H142Y probably benign Het
Tent5c A G 3: 100,380,138 (GRCm39) F206S probably benign Het
Tmem117 G A 15: 94,992,679 (GRCm39) M446I probably benign Het
Trav7-6 G A 14: 53,954,550 (GRCm39) D47N probably benign Het
Trim2 C A 3: 84,100,646 (GRCm39) A162S probably damaging Het
Ttc28 A G 5: 111,373,596 (GRCm39) I1011V possibly damaging Het
Vmn2r98 T C 17: 19,301,425 (GRCm39) V809A probably damaging Het
Wfikkn1 T A 17: 26,097,071 (GRCm39) T418S probably benign Het
Zbtb41 T A 1: 139,356,919 (GRCm39) D391E possibly damaging Het
Zfp109 G A 7: 23,928,635 (GRCm39) S266F probably damaging Het
Other mutations in Cap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Cap2 APN 13 46,793,425 (GRCm39) splice site probably benign
IGL01927:Cap2 APN 13 46,789,109 (GRCm39) missense probably benign 0.03
IGL02213:Cap2 APN 13 46,789,087 (GRCm39) splice site probably benign
IGL02511:Cap2 APN 13 46,684,498 (GRCm39) start codon destroyed probably null 0.12
IGL02871:Cap2 APN 13 46,678,968 (GRCm39) missense probably benign 0.00
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0063:Cap2 UTSW 13 46,791,508 (GRCm39) splice site probably benign
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0234:Cap2 UTSW 13 46,791,498 (GRCm39) critical splice donor site probably null
R0385:Cap2 UTSW 13 46,714,023 (GRCm39) missense probably damaging 1.00
R0387:Cap2 UTSW 13 46,713,992 (GRCm39) missense probably damaging 0.99
R0712:Cap2 UTSW 13 46,768,837 (GRCm39) splice site probably null
R1489:Cap2 UTSW 13 46,763,111 (GRCm39) missense probably damaging 1.00
R1666:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1668:Cap2 UTSW 13 46,768,799 (GRCm39) missense probably damaging 0.98
R1676:Cap2 UTSW 13 46,791,335 (GRCm39) missense probably damaging 1.00
R1756:Cap2 UTSW 13 46,684,489 (GRCm39) missense probably benign 0.11
R1822:Cap2 UTSW 13 46,768,823 (GRCm39) missense probably benign 0.03
R1867:Cap2 UTSW 13 46,793,555 (GRCm39) missense probably damaging 1.00
R1972:Cap2 UTSW 13 46,791,375 (GRCm39) missense probably damaging 0.98
R1990:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1991:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R1992:Cap2 UTSW 13 46,791,357 (GRCm39) missense possibly damaging 0.93
R2144:Cap2 UTSW 13 46,713,978 (GRCm39) critical splice acceptor site probably null
R3039:Cap2 UTSW 13 46,793,317 (GRCm39) missense probably benign 0.20
R4024:Cap2 UTSW 13 46,791,317 (GRCm39) splice site probably benign
R4554:Cap2 UTSW 13 46,789,250 (GRCm39) missense probably damaging 1.00
R4748:Cap2 UTSW 13 46,793,302 (GRCm39) missense possibly damaging 0.64
R4821:Cap2 UTSW 13 46,763,586 (GRCm39) missense probably damaging 0.99
R4876:Cap2 UTSW 13 46,684,497 (GRCm39) start codon destroyed probably null
R4902:Cap2 UTSW 13 46,684,501 (GRCm39) missense probably damaging 0.99
R5320:Cap2 UTSW 13 46,801,840 (GRCm39) makesense probably null
R5666:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R5670:Cap2 UTSW 13 46,684,559 (GRCm39) splice site probably null
R6086:Cap2 UTSW 13 46,789,188 (GRCm39) missense probably damaging 1.00
R6728:Cap2 UTSW 13 46,793,335 (GRCm39) missense possibly damaging 0.87
R6842:Cap2 UTSW 13 46,800,101 (GRCm39) missense probably damaging 1.00
R7785:Cap2 UTSW 13 46,789,224 (GRCm39) missense probably benign
R7889:Cap2 UTSW 13 46,800,051 (GRCm39) missense probably damaging 0.99
R8065:Cap2 UTSW 13 46,791,337 (GRCm39) missense probably damaging 1.00
R8425:Cap2 UTSW 13 46,763,208 (GRCm39) missense probably damaging 0.98
R8731:Cap2 UTSW 13 46,800,006 (GRCm39) missense probably benign 0.00
R8738:Cap2 UTSW 13 46,684,548 (GRCm39) missense probably benign 0.00
R9320:Cap2 UTSW 13 46,768,818 (GRCm39) missense probably benign 0.04
R9491:Cap2 UTSW 13 46,791,366 (GRCm39) missense possibly damaging 0.92
R9686:Cap2 UTSW 13 46,678,926 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCATCACTAGGTATGGCAC -3'
(R):5'- TTTCTATGGCCACCCGGGATAC -3'

Sequencing Primer
(F):5'- GTCTGTCTAGACCCAAAGTTGG -3'
(R):5'- GGGATACACATCTTCACAAGTGTC -3'
Posted On 2020-07-13