Incidental Mutation 'R8205:Vmn2r98'
ID635887
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Namevomeronasal 2, receptor 98
SynonymsEG224552
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R8205 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location19053460-19082411 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19081163 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 809 (V809A)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: V809A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: V809A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Cap2 G A 13: 46,615,263 V182M probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Fgd3 T C 13: 49,296,347 D142G probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mex3a T C 3: 88,536,852 S412P possibly damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Ndufaf7 G A 17: 78,947,032 C418Y probably benign Het
Nlrp4a A G 7: 26,450,794 S609G probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Odf2l A G 3: 145,150,734 probably benign Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Sacm1l G A 9: 123,586,659 probably null Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCCTTGGGAGTTATGC -3'
(R):5'- AGGCATCAGGTCTTAGATTCAG -3'

Sequencing Primer
(F):5'- GGAGTTATGCCATGGCCTTC -3'
(R):5'- CATCAGGTCTTAGATTCAGAGAAGC -3'
Posted On2020-07-13