Incidental Mutation 'R8205:Vmn2r98'
ID 635887
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock # R8205 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 19053460-19082411 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19081163 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 809 (V809A)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably damaging
Transcript: ENSMUST00000170424
AA Change: V809A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: V809A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Cap2 G A 13: 46,615,263 V182M probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Fgd3 T C 13: 49,296,347 D142G probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mex3a T C 3: 88,536,852 S412P possibly damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Ndufaf7 G A 17: 78,947,032 C418Y probably benign Het
Nlrp4a A G 7: 26,450,794 S609G probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Odf2l A G 3: 145,150,734 probably benign Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Sacm1l G A 9: 123,586,659 probably null Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19065745 splice site probably benign
IGL01296:Vmn2r98 APN 17 19065185 missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19065758 missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19065259 missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19066451 missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19066440 missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19066286 missense probably benign
IGL02123:Vmn2r98 APN 17 19080679 missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19065851 missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19065821 missense probably benign
IGL02650:Vmn2r98 APN 17 19080961 missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19065259 missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19066013 missense probably benign
IGL02807:Vmn2r98 APN 17 19081021 missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19065980 missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19069845 missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19080961 missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19066400 missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19066347 missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19065827 nonsense probably null
R0545:Vmn2r98 UTSW 17 19053613 missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19080497 missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19080520 missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19080749 missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19065948 missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19065178 missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19080908 missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19066440 missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19066418 missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19065333 nonsense probably null
R2165:Vmn2r98 UTSW 17 19081291 missense unknown
R2238:Vmn2r98 UTSW 17 19065951 missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19080436 missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19065819 missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19081177 missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19067402 missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19065863 missense probably benign 0.01
R3788:Vmn2r98 UTSW 17 19080625 missense probably benign 0.31
R4570:Vmn2r98 UTSW 17 19066092 missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19069745 missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19066340 missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19066157 missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19066044 missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19053553 missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19080719 missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19069754 nonsense probably null
R5371:Vmn2r98 UTSW 17 19069753 missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19067383 missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19080899 missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19065998 missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19066074 missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19065881 missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19065801 missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19065248 missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19066268 missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19080922 missense probably benign
R7068:Vmn2r98 UTSW 17 19065313 missense probably benign
R7607:Vmn2r98 UTSW 17 19067308 missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19080535 missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19067198 splice site probably null
R7915:Vmn2r98 UTSW 17 19067231 missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19053650 missense probably benign 0.00
R8241:Vmn2r98 UTSW 17 19080769 missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19066270 missense probably benign
R8952:Vmn2r98 UTSW 17 19065269 missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19066121 missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19081219 missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19066515 missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19067255 missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19081234 missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19065403 missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19065136 critical splice acceptor site probably null
Z1177:Vmn2r98 UTSW 17 19067423 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATGGCCCTTGGGAGTTATGC -3'
(R):5'- AGGCATCAGGTCTTAGATTCAG -3'

Sequencing Primer
(F):5'- GGAGTTATGCCATGGCCTTC -3'
(R):5'- CATCAGGTCTTAGATTCAGAGAAGC -3'
Posted On 2020-07-13