Incidental Mutation 'R8205:Ndufaf7'
ID635892
Institutional Source Beutler Lab
Gene Symbol Ndufaf7
Ensembl Gene ENSMUSG00000024082
Gene NameNADH dehydrogenase (ubiquinone) 1 alpha subcomplex assembly factor 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8205 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78937135-78948052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78947032 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 418 (C418Y)
Ref Sequence ENSEMBL: ENSMUSP00000024887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003191] [ENSMUST00000024887] [ENSMUST00000118768] [ENSMUST00000119284] [ENSMUST00000168887]
Predicted Effect probably benign
Transcript: ENSMUST00000003191
SMART Domains Protein: ENSMUSP00000003191
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024887
AA Change: C418Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024887
Gene: ENSMUSG00000024082
AA Change: C418Y

DomainStartEndE-ValueType
Pfam:Methyltransf_28 95 349 5.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118768
SMART Domains Protein: ENSMUSP00000113232
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 60 109 1.95e-13 SMART
C1 177 226 1.26e-16 SMART
PH 322 439 1.18e-10 SMART
S_TKc 481 737 4.5e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119284
SMART Domains Protein: ENSMUSP00000113395
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 576 832 4.5e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168887
SMART Domains Protein: ENSMUSP00000132004
Gene: ENSMUSG00000024070

DomainStartEndE-ValueType
C1 155 204 1.95e-13 SMART
C1 272 321 1.26e-16 SMART
PH 417 534 1.18e-10 SMART
S_TKc 575 831 4.5e-90 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an assembly factor protein which helps in the assembly and stabilization of Complex I, a large multi-subunit enzyme in the mitochondrial respiratory chain. Complex I is involved in several physiological activities in the cell, including metabolite transport and ATP synthesis. The encoded protein is a methyltransferase which methylates Arg85 of a subunit of Complex I in the early stages of its assembly. A pseudogene related to this gene is located on chromosome 8. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
PHENOTYPE: Embryos homozygous for a gene trap mutation die prenatally. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik T C 1: 37,624,966 D617G probably benign Het
Adam39 T C 8: 40,825,043 V157A probably benign Het
Adamtsl1 A G 4: 86,199,413 *204W probably null Het
Add2 A G 6: 86,086,917 E66G probably damaging Het
Adgrd1 A G 5: 129,115,111 T114A possibly damaging Het
Aldh7a1 A T 18: 56,544,998 I247N probably damaging Het
Ankrd13d A T 19: 4,280,981 M166K probably damaging Het
Brd7 A G 8: 88,343,615 F388L probably damaging Het
Cap2 G A 13: 46,615,263 V182M probably damaging Het
Col22a1 A T 15: 71,861,069 V1100E unknown Het
Crisp2 T C 17: 40,785,078 E63G possibly damaging Het
Dst T G 1: 34,214,604 W2304G probably damaging Het
Eif2a A C 3: 58,548,735 N385T probably damaging Het
Eif4ebp2 A T 10: 61,434,925 H108Q probably benign Het
Fam46c A G 3: 100,472,822 F206S probably benign Het
Fgd3 T C 13: 49,296,347 D142G probably benign Het
Gbp8 T A 5: 105,050,980 H23L probably benign Het
Glt1d1 A G 5: 127,691,016 E229G probably benign Het
Gm428 G A 4: 73,687,305 V318I possibly damaging Het
Gm4955 T C 1: 173,481,884 E182G Het
Gpatch8 T C 11: 102,480,387 D775G unknown Het
Heatr1 T C 13: 12,416,047 Y1008H probably benign Het
Heatr5a T A 12: 51,959,009 N61I probably benign Het
Hydin A T 8: 110,592,638 H4391L possibly damaging Het
Mbtps1 A G 8: 119,520,338 S789P probably damaging Het
Mex3a T C 3: 88,536,852 S412P possibly damaging Het
Mup2 T A 4: 60,137,659 D128V probably benign Het
Nlrp4a A G 7: 26,450,794 S609G probably benign Het
Obscn T A 11: 59,007,871 Y6554F unknown Het
Odf2l A G 3: 145,150,734 probably benign Het
Olfr108 T C 17: 37,446,289 V245A probably damaging Het
Olfr113 A T 17: 37,575,001 C141S probably damaging Het
Olfr1199 A T 2: 88,756,672 M1K probably null Het
Plod2 G T 9: 92,542,318 probably benign Het
Ptgfr A G 3: 151,835,781 V30A probably benign Het
Pxdn T G 12: 30,006,567 L1259R probably damaging Het
Rnf6 A G 5: 146,210,904 S435P probably damaging Het
Sacm1l G A 9: 123,586,659 probably null Het
Scgb2b26 T C 7: 33,944,408 T36A probably benign Het
Slc1a7 A G 4: 108,008,311 N332S probably benign Het
Slfn5 T C 11: 82,960,718 F614L probably benign Het
Smad7 C A 18: 75,394,048 Q322K probably damaging Het
Smap1 T C 1: 23,849,426 T253A probably benign Het
Socs5 G T 17: 87,133,710 R26L probably benign Het
Steap4 A T 5: 7,976,795 I253F possibly damaging Het
Tacc1 G A 8: 25,182,787 H142Y probably benign Het
Tmem117 G A 15: 95,094,798 M446I probably benign Het
Trav7-6 G A 14: 53,717,093 D47N probably benign Het
Trim2 C A 3: 84,193,339 A162S probably damaging Het
Ttc28 A G 5: 111,225,730 I1011V possibly damaging Het
Vmn2r98 T C 17: 19,081,163 V809A probably damaging Het
Wfikkn1 T A 17: 25,878,097 T418S probably benign Het
Zbtb41 T A 1: 139,429,181 D391E possibly damaging Het
Zfp109 G A 7: 24,229,210 S266F probably damaging Het
Other mutations in Ndufaf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Ndufaf7 APN 17 78947091 unclassified probably benign
IGL01571:Ndufaf7 APN 17 78943852 missense probably damaging 0.96
IGL01613:Ndufaf7 APN 17 78937502 missense probably benign 0.01
IGL01763:Ndufaf7 APN 17 78946342 missense possibly damaging 0.76
IGL03149:Ndufaf7 APN 17 78945010 missense possibly damaging 0.86
R0540:Ndufaf7 UTSW 17 78946456 missense probably benign 0.02
R1728:Ndufaf7 UTSW 17 78937629 missense probably damaging 0.99
R1729:Ndufaf7 UTSW 17 78937629 missense probably damaging 0.99
R1784:Ndufaf7 UTSW 17 78937629 missense probably damaging 0.99
R1907:Ndufaf7 UTSW 17 78942117 missense possibly damaging 0.95
R2119:Ndufaf7 UTSW 17 78945013 missense possibly damaging 0.76
R2369:Ndufaf7 UTSW 17 78945032 missense probably damaging 0.99
R4167:Ndufaf7 UTSW 17 78944986 missense probably benign 0.00
R4555:Ndufaf7 UTSW 17 78942087 missense probably benign 0.05
R4556:Ndufaf7 UTSW 17 78942087 missense probably benign 0.05
R5236:Ndufaf7 UTSW 17 78939631 missense probably benign 0.23
R5405:Ndufaf7 UTSW 17 78938615 missense probably damaging 1.00
R5514:Ndufaf7 UTSW 17 78937622 missense probably damaging 1.00
R6377:Ndufaf7 UTSW 17 78943310 missense probably null 0.99
R7440:Ndufaf7 UTSW 17 78942117 missense probably damaging 0.98
R8280:Ndufaf7 UTSW 17 78943846 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAAGGCCTTTCTTTCCGCTCAG -3'
(R):5'- ACAAACCAATCAGTGCTCATATGTG -3'

Sequencing Primer
(F):5'- CTCAGGTTCTCTTGGATAAAGCAG -3'
(R):5'- CCTCCCGAGTGCTAGGATTAAAG -3'
Posted On2020-07-13