Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Nrp2'

635897

Institutional Source

Beutler Lab

Gene Symbol

Nrp2

Ensembl Gene

ENSMUSG00000025969

Gene Name

neuropilin 2

Synonyms

Npn2, NP-2, NP2, Npn-2, 1110048P06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62703285-62818695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 62747215 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 293 (I293T)

Ref Sequence

ENSEMBL: ENSMUSP00000109794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027112] [ENSMUST00000063594] [ENSMUST00000075144] [ENSMUST00000102822] [ENSMUST00000114155] [ENSMUST00000114157]

AlphaFold

O35375

Predicted Effect

probably damaging
Transcript: ENSMUST00000027112
AA Change: I293T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000027112
Gene: ENSMUSG00000025969
AA Change: I293T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	822	906	1.4e-35	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000063594
AA Change: I293T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000069379
Gene: ENSMUSG00000025969
AA Change: I293T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
low complexity region	816	831	N/A	INTRINSIC
Pfam:DUF3481	839	923	1.6e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000075144
AA Change: I293T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000074642
Gene: ENSMUSG00000025969
AA Change: I293T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	827	911	2.3e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102822
AA Change: I293T

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000099886
Gene: ENSMUSG00000025969
AA Change: I293T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	822	906	2.3e-25	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114155
AA Change: I293T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000109792
Gene: ENSMUSG00000025969
AA Change: I293T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
Pfam:DUF3481	817	901	9.4e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000114157
AA Change: I293T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000109794
Gene: ENSMUSG00000025969
AA Change: I293T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
CUB	28	142	3.4e-45	SMART
CUB	149	267	1.04e-40	SMART
FA58C	276	427	1.63e-45	SMART
FA58C	433	592	9.33e-14	SMART
MAM	641	802	2.31e-60	SMART
low complexity region	821	836	N/A	INTRINSIC
Pfam:DUF3481	844	928	2.4e-25	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuropilin family of receptor proteins. The encoded transmembrane protein binds to SEMA3C protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C} and SEMA3F protein {sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3F}, and interacts with vascular endothelial growth factor (VEGF). This protein may play a role in cardiovascular development, axon guidance, and tumorigenesis. Multiple transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice may exhibit pre- or postnatal lethality, reduced fertility, hydrocephalus, aberrant sensory innervation, reduced interneuron count, seizure susceptibility and abnormal lymphangiogenesis. Homozygotes for a gene trap allele show abnormal neuronal development and axonal trajectories. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Nrp2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00765:Nrp2	APN	1	62704251	nonsense	probably null
IGL01912:Nrp2	APN	1	62771737	missense	probably damaging	1.00
IGL01996:Nrp2	APN	1	62749260	missense	probably damaging	1.00
IGL02184:Nrp2	APN	1	62718940	nonsense	probably null
IGL02682:Nrp2	APN	1	62771837	missense	probably benign	0.03
IGL02928:Nrp2	APN	1	62815446	missense	probably damaging	1.00
IGL03024:Nrp2	APN	1	62771734	missense	probably damaging	1.00
Euphorbia	UTSW	1	62762813	missense	probably benign	0.02
Sabra	UTSW	1	62783521	missense	probably damaging	1.00
R0068:Nrp2	UTSW	1	62745377	missense	possibly damaging	0.95
R0068:Nrp2	UTSW	1	62745377	missense	possibly damaging	0.95
R0683:Nrp2	UTSW	1	62744318	missense	probably benign	0.41
R0789:Nrp2	UTSW	1	62745450	missense	probably benign	0.44
R1418:Nrp2	UTSW	1	62783332	nonsense	probably null
R1468:Nrp2	UTSW	1	62738299	missense	probably damaging	1.00
R1468:Nrp2	UTSW	1	62738299	missense	probably damaging	1.00
R1544:Nrp2	UTSW	1	62762904	missense	probably damaging	1.00
R1645:Nrp2	UTSW	1	62785124	missense	probably damaging	0.97
R1677:Nrp2	UTSW	1	62783320	missense	probably benign	0.18
R1752:Nrp2	UTSW	1	62738441	missense	probably damaging	1.00
R1840:Nrp2	UTSW	1	62738339	missense	probably damaging	1.00
R1916:Nrp2	UTSW	1	62762747	missense	probably damaging	1.00
R1962:Nrp2	UTSW	1	62718931	missense	probably benign	0.03
R2108:Nrp2	UTSW	1	62744277	missense	probably damaging	1.00
R2164:Nrp2	UTSW	1	62744355	missense	probably damaging	1.00
R2216:Nrp2	UTSW	1	62762918	nonsense	probably null
R2679:Nrp2	UTSW	1	62785078	missense	probably benign	0.00
R4349:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4351:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4352:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4353:Nrp2	UTSW	1	62738417	missense	probably damaging	1.00
R4811:Nrp2	UTSW	1	62719081	missense	probably damaging	1.00
R5362:Nrp2	UTSW	1	62769062	missense	probably benign	0.01
R5387:Nrp2	UTSW	1	62762813	missense	probably benign	0.02
R5461:Nrp2	UTSW	1	62747211	nonsense	probably null
R5704:Nrp2	UTSW	1	62785108	missense	probably benign	0.00
R6143:Nrp2	UTSW	1	62760815	missense	probably damaging	1.00
R6303:Nrp2	UTSW	1	62745406	missense	probably damaging	1.00
R6304:Nrp2	UTSW	1	62745406	missense	probably damaging	1.00
R6376:Nrp2	UTSW	1	62719017	missense	possibly damaging	0.65
R6945:Nrp2	UTSW	1	62760788	missense	probably damaging	1.00
R7347:Nrp2	UTSW	1	62745504	missense	probably benign	0.04
R7393:Nrp2	UTSW	1	62745424	missense	probably damaging	0.98
R7593:Nrp2	UTSW	1	62719044	missense	probably damaging	0.96
R7881:Nrp2	UTSW	1	62771831	missense	probably benign	0.42
R7882:Nrp2	UTSW	1	62783521	missense	probably damaging	1.00
R7948:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7958:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7959:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7960:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R7961:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8009:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8012:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8014:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8015:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8068:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8069:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8070:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8071:Nrp2	UTSW	1	62745408	missense	probably damaging	1.00
R8791:Nrp2	UTSW	1	62749197	missense	probably damaging	1.00
R9090:Nrp2	UTSW	1	62745511	missense	probably benign	0.21
R9271:Nrp2	UTSW	1	62745511	missense	probably benign	0.21
R9287:Nrp2	UTSW	1	62795855	missense	probably damaging	1.00
R9469:Nrp2	UTSW	1	62764871	missense	probably damaging	1.00
R9646:Nrp2	UTSW	1	62738407	missense	probably damaging	1.00
R9752:Nrp2	UTSW	1	62812567	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TAGTTCCTTGAAGACCCAGAGG -3'
(R):5'- GCCGAGGGAACACATCACTATC -3'

Sequencing Primer
(F):5'- CCAGAGGGGTTGTTAACTATGTGAC -3'
(R):5'- TATCCCATCAGCAGATCCATTC -3'

Posted On

2020-07-13