Incidental Mutation 'R8206:Slc13a3'
ID635899
Institutional Source Beutler Lab
Gene Symbol Slc13a3
Ensembl Gene ENSMUSG00000018459
Gene Namesolute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3
SynonymsSDCT2, NaDC-3, NaDC3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location165405028-165473230 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 165406825 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 553 (G553D)
Ref Sequence ENSEMBL: ENSMUSP00000029208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029208] [ENSMUST00000109279]
Predicted Effect probably damaging
Transcript: ENSMUST00000029208
AA Change: G553D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029208
Gene: ENSMUSG00000018459
AA Change: G553D

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 571 2.6e-110 PFAM
Pfam:CitMHS 43 167 1.4e-15 PFAM
Pfam:CitMHS 221 486 5.3e-18 PFAM
low complexity region 578 596 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109279
AA Change: G511D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104902
Gene: ENSMUSG00000018459
AA Change: G511D

DomainStartEndE-ValueType
Pfam:Na_sulph_symp 9 270 6.7e-49 PFAM
Pfam:Na_sulph_symp 265 529 1.9e-51 PFAM
low complexity region 536 554 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Slc13a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00310:Slc13a3 APN 2 165411923 missense probably damaging 1.00
IGL00326:Slc13a3 APN 2 165473097 missense possibly damaging 0.89
IGL01308:Slc13a3 APN 2 165406780 missense probably damaging 0.99
IGL01668:Slc13a3 APN 2 165430292 missense probably damaging 1.00
IGL02435:Slc13a3 APN 2 165408940 missense possibly damaging 0.95
IGL02551:Slc13a3 APN 2 165424573 missense probably damaging 1.00
IGL02716:Slc13a3 APN 2 165406715 missense unknown
IGL03107:Slc13a3 APN 2 165437307 missense probably benign 0.00
R0114:Slc13a3 UTSW 2 165424581 missense probably damaging 1.00
R0624:Slc13a3 UTSW 2 165411887 missense probably damaging 1.00
R1051:Slc13a3 UTSW 2 165408820 critical splice donor site probably null
R1780:Slc13a3 UTSW 2 165406699 missense unknown
R1782:Slc13a3 UTSW 2 165445519 missense probably benign 0.01
R1994:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R4739:Slc13a3 UTSW 2 165430289 missense possibly damaging 0.91
R4971:Slc13a3 UTSW 2 165448699 missense probably damaging 0.99
R5091:Slc13a3 UTSW 2 165420080 missense probably benign 0.11
R5093:Slc13a3 UTSW 2 165411896 missense probably damaging 1.00
R5826:Slc13a3 UTSW 2 165408956 missense probably benign 0.05
R5894:Slc13a3 UTSW 2 165424623 missense probably benign 0.00
R6239:Slc13a3 UTSW 2 165406697 missense unknown
R6394:Slc13a3 UTSW 2 165434097 missense probably damaging 1.00
R6453:Slc13a3 UTSW 2 165411947 missense possibly damaging 0.94
R6463:Slc13a3 UTSW 2 165445653 missense probably damaging 1.00
R6480:Slc13a3 UTSW 2 165408898 missense probably damaging 1.00
R6525:Slc13a3 UTSW 2 165406747 missense unknown
R6879:Slc13a3 UTSW 2 165430301 missense probably damaging 1.00
R7278:Slc13a3 UTSW 2 165445528 missense possibly damaging 0.87
R7340:Slc13a3 UTSW 2 165430290 missense probably benign 0.00
R7404:Slc13a3 UTSW 2 165434064 missense possibly damaging 0.90
R7452:Slc13a3 UTSW 2 165427114 missense probably benign 0.03
R7585:Slc13a3 UTSW 2 165430322 missense probably benign 0.00
R7966:Slc13a3 UTSW 2 165430235 missense probably benign 0.08
R8504:Slc13a3 UTSW 2 165434079 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGATCAGCTTGGAGGCTCCTAG -3'
(R):5'- CTGGGAAACATCTGTGGCCTAC -3'

Sequencing Primer
(F):5'- TGACAGCAACAGCCTTCTGGAG -3'
(R):5'- ACACTTGTGGCTGGCTC -3'
Posted On2020-07-13