Incidental Mutation 'R8206:Cyp24a1'
ID 635900
Institutional Source Beutler Lab
Gene Symbol Cyp24a1
Ensembl Gene ENSMUSG00000038567
Gene Name cytochrome P450, family 24, subfamily a, polypeptide 1
Synonyms CP24, 24-OHase, Cyp24, 25-hydroxyvitamin D-24-hydroxylase
MMRRC Submission
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.420) question?
Stock # R8206 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 170482708-170497145 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 170491669 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 255 (T255A)
Ref Sequence ENSEMBL: ENSMUSP00000047954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038824] [ENSMUST00000075087]
AlphaFold Q64441
Predicted Effect possibly damaging
Transcript: ENSMUST00000038824
AA Change: T255A

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047954
Gene: ENSMUSG00000038567
AA Change: T255A

DomainStartEndE-ValueType
Pfam:p450 58 511 6e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075087
SMART Domains Protein: ENSMUSP00000074596
Gene: ENSMUSG00000052033

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 69 1.9e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: The protein encoded by this gene localizes to the mitochondrion, where it degrades calcitriol to calcitetrol. This gene is upregulated by binding of calcitriol to the upstream regulatory region and to a downstream enhancer region, thereby allowing calcitriol to autoregulate its concentration in the cell. The encoded protein may also play a role in calcium homeostasis. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for disruption of this gene suffer a 50% mortality rate between birth and weaning. abnormalities are seen in the development of membranous bones. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Cyp24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Cyp24a1 APN 2 170496566 missense probably damaging 1.00
IGL02187:Cyp24a1 APN 2 170494093 missense probably damaging 1.00
IGL02269:Cyp24a1 APN 2 170496572 missense probably damaging 1.00
IGL02273:Cyp24a1 APN 2 170496358 missense probably damaging 1.00
IGL03089:Cyp24a1 APN 2 170485966 missense probably damaging 1.00
R0359:Cyp24a1 UTSW 2 170491699 missense possibly damaging 0.94
R1037:Cyp24a1 UTSW 2 170491617 missense probably damaging 1.00
R1243:Cyp24a1 UTSW 2 170495406 missense probably benign 0.28
R1601:Cyp24a1 UTSW 2 170485691 missense possibly damaging 0.48
R1696:Cyp24a1 UTSW 2 170486043 missense probably benign 0.10
R1839:Cyp24a1 UTSW 2 170496741 missense probably benign
R1845:Cyp24a1 UTSW 2 170487917 missense probably benign 0.06
R4832:Cyp24a1 UTSW 2 170496178 missense probably benign 0.07
R5649:Cyp24a1 UTSW 2 170496309 missense possibly damaging 0.87
R6320:Cyp24a1 UTSW 2 170486784 missense probably benign 0.13
R6668:Cyp24a1 UTSW 2 170485885 critical splice donor site probably null
R6823:Cyp24a1 UTSW 2 170487979 missense probably benign 0.12
R6953:Cyp24a1 UTSW 2 170487946 missense probably benign
R7136:Cyp24a1 UTSW 2 170494143 missense probably benign 0.15
R7287:Cyp24a1 UTSW 2 170485906 missense probably damaging 1.00
R7831:Cyp24a1 UTSW 2 170485940 missense probably damaging 1.00
R7893:Cyp24a1 UTSW 2 170496516 critical splice donor site probably null
R8193:Cyp24a1 UTSW 2 170485702 missense probably damaging 1.00
R8296:Cyp24a1 UTSW 2 170490116 missense probably damaging 1.00
R8384:Cyp24a1 UTSW 2 170486769 critical splice donor site probably null
R9005:Cyp24a1 UTSW 2 170494085 missense probably damaging 1.00
R9091:Cyp24a1 UTSW 2 170485933 missense probably damaging 1.00
R9226:Cyp24a1 UTSW 2 170496357 missense probably damaging 1.00
R9270:Cyp24a1 UTSW 2 170485933 missense probably damaging 1.00
R9776:Cyp24a1 UTSW 2 170496705 missense probably benign 0.10
X0061:Cyp24a1 UTSW 2 170485990 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGTTCAGTCAGACAGATCACAC -3'
(R):5'- GGAGATCTTGGGTTCCATTCCC -3'

Sequencing Primer
(F):5'- CTACGCCCATCCTAGACAGAGG -3'
(R):5'- GGGTTCCATTCCCAGTACAAC -3'
Posted On 2020-07-13