Incidental Mutation 'R8206:Gm14325'
ID635901
Institutional Source Beutler Lab
Gene Symbol Gm14325
Ensembl Gene ENSMUSG00000095362
Gene Namepredicted gene 14325
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.305) question?
Stock #R8206 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location177831791-177840336 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 177832974 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 105 (C105F)
Ref Sequence ENSEMBL: ENSMUSP00000104567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108939] [ENSMUST00000150650] [ENSMUST00000188914]
Predicted Effect probably damaging
Transcript: ENSMUST00000108939
AA Change: C105F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104567
Gene: ENSMUSG00000095362
AA Change: C105F

DomainStartEndE-ValueType
KRAB 4 64 3.43e-13 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 3.34e-2 SMART
ZnF_C2H2 159 181 5.29e-5 SMART
ZnF_C2H2 187 209 6.08e-5 SMART
ZnF_C2H2 215 237 5.99e-4 SMART
ZnF_C2H2 243 265 8.02e-5 SMART
ZnF_C2H2 271 293 3.83e-2 SMART
ZnF_C2H2 299 321 5.14e-3 SMART
ZnF_C2H2 327 349 5.14e-3 SMART
ZnF_C2H2 355 377 5.99e-4 SMART
ZnF_C2H2 383 405 1.69e-3 SMART
ZnF_C2H2 411 433 7.37e-4 SMART
ZnF_C2H2 439 461 4.94e-5 SMART
ZnF_C2H2 467 489 1.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150650
SMART Domains Protein: ENSMUSP00000118192
Gene: ENSMUSG00000095362

DomainStartEndE-ValueType
KRAB 4 64 3.43e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188914
AA Change: C104F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140685
Gene: ENSMUSG00000095362
AA Change: C104F

DomainStartEndE-ValueType
KRAB 3 63 1.4e-15 SMART
ZnF_C2H2 77 96 6.8e-1 SMART
ZnF_C2H2 102 124 1.8e-5 SMART
ZnF_C2H2 130 152 1.4e-4 SMART
ZnF_C2H2 158 180 2.3e-7 SMART
ZnF_C2H2 186 208 2.5e-7 SMART
ZnF_C2H2 214 236 2.5e-6 SMART
ZnF_C2H2 242 264 3.3e-7 SMART
ZnF_C2H2 270 292 1.6e-4 SMART
ZnF_C2H2 298 320 2.1e-5 SMART
ZnF_C2H2 326 348 2.1e-5 SMART
ZnF_C2H2 354 376 2.5e-6 SMART
ZnF_C2H2 382 404 7.3e-6 SMART
ZnF_C2H2 410 432 3.1e-6 SMART
ZnF_C2H2 438 460 2e-7 SMART
ZnF_C2H2 466 488 4.6e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Gm14325
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Gm14325 APN 2 177834652 unclassified probably benign
IGL02731:Gm14325 APN 2 177832986 missense probably damaging 1.00
IGL02988:Gm14325 APN 2 177834249 critical splice donor site probably null
R4490:Gm14325 UTSW 2 177832983 missense possibly damaging 0.95
R5274:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5277:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5295:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5394:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R5395:Gm14325 UTSW 2 177832984 missense possibly damaging 0.92
R6147:Gm14325 UTSW 2 177832807 missense probably damaging 1.00
R6855:Gm14325 UTSW 2 177832842 missense probably damaging 1.00
R7198:Gm14325 UTSW 2 177832005 missense probably benign 0.02
R7221:Gm14325 UTSW 2 177834610 missense probably damaging 1.00
R8310:Gm14325 UTSW 2 177831799 missense probably damaging 1.00
R8370:Gm14325 UTSW 2 177832592 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGCTTTGTGAAAAGGCTTTACCAC -3'
(R):5'- GATTGCTCTGTTCAATGAAACCAAA -3'

Sequencing Primer
(F):5'- TGGAGTTCACCACTGCTTACAAAG -3'
(R):5'- GAAGTTGTTCTGCAGAGC -3'
Posted On2020-07-13