Incidental Mutation 'R8206:Myl10'
ID635905
Institutional Source Beutler Lab
Gene Symbol Myl10
Ensembl Gene ENSMUSG00000005474
Gene Namemyosin, light chain 10, regulatory
SynonymsPLRLC-C, 1700027I08Rik, PLRLC, PLRLC-A, Mylc2pl, PLRLC-B
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136693146-136701094 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 136697971 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 70 (V70L)
Ref Sequence ENSEMBL: ENSMUSP00000143165 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005611] [ENSMUST00000196068] [ENSMUST00000196436] [ENSMUST00000197186]
Predicted Effect probably benign
Transcript: ENSMUST00000005611
AA Change: V86L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000005611
Gene: ENSMUSG00000005474
AA Change: V86L

DomainStartEndE-ValueType
EFh 9 37 1.5e-5 SMART
EFh 79 107 3.16e1 SMART
Blast:EFh 115 143 6e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196068
AA Change: K115N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000142570
Gene: ENSMUSG00000005474
AA Change: K115N

DomainStartEndE-ValueType
Pfam:EF-hand_1 9 37 9.4e-7 PFAM
Pfam:EF-hand_6 9 40 9.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196436
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142495
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000197186
AA Change: V70L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143165
Gene: ENSMUSG00000005474
AA Change: V70L

DomainStartEndE-ValueType
Pfam:EF-hand_6 1 24 5.4e-3 PFAM
Pfam:EF-hand_8 5 39 1.3e-3 PFAM
Blast:EFh 63 91 1e-11 BLAST
Blast:EFh 99 127 4e-14 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197849
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199074
Meta Mutation Damage Score 0.0667 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Myl10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03206:Myl10 APN 5 136697942 nonsense probably null
PIT4243001:Myl10 UTSW 5 136694293 missense probably benign 0.05
R4066:Myl10 UTSW 5 136695450 missense probably damaging 1.00
R5712:Myl10 UTSW 5 136694238 missense probably damaging 1.00
R6321:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6322:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6566:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6756:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6757:Myl10 UTSW 5 136697971 missense probably benign 0.00
R6894:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7033:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7152:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7242:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7411:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7484:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7535:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7537:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7630:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7631:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7635:Myl10 UTSW 5 136700864 missense probably benign 0.00
R7764:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7829:Myl10 UTSW 5 136697971 missense probably benign 0.00
R7969:Myl10 UTSW 5 136700853 critical splice acceptor site probably null
R8065:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8066:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8067:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8202:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8203:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8204:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8217:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8248:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8300:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8301:Myl10 UTSW 5 136697971 missense probably benign 0.00
R8343:Myl10 UTSW 5 136697971 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CATGCTGTGTAATGATGCAGCTG -3'
(R):5'- TATACCAGGAGGAACGGCTG -3'

Sequencing Primer
(F):5'- CTGCCTAGAATCTTCCAGTGAGG -3'
(R):5'- CAGGAGGAACGGCTGGTTTG -3'
Posted On2020-07-13