Incidental Mutation 'R8206:Tas2r144'
ID635908
Institutional Source Beutler Lab
Gene Symbol Tas2r144
Ensembl Gene ENSMUSG00000051917
Gene Nametaste receptor, type 2, member 144
Synonymsmt2r33, Tas2r44
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location42215328-42216287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42215391 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 22 (V22M)
Ref Sequence ENSEMBL: ENSMUSP00000067734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063489]
Predicted Effect probably damaging
Transcript: ENSMUST00000063489
AA Change: V22M

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000067734
Gene: ENSMUSG00000051917
AA Change: V22M

DomainStartEndE-ValueType
Pfam:TAS2R 12 314 9.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Tas2r144
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02349:Tas2r144 APN 6 42216076 missense probably benign 0.26
IGL02644:Tas2r144 APN 6 42215853 missense possibly damaging 0.89
IGL02816:Tas2r144 APN 6 42215605 missense probably benign 0.03
R0375:Tas2r144 UTSW 6 42216124 missense possibly damaging 0.92
R1526:Tas2r144 UTSW 6 42215740 missense probably benign
R1543:Tas2r144 UTSW 6 42215603 missense probably benign 0.00
R1678:Tas2r144 UTSW 6 42215556 missense probably benign 0.44
R1868:Tas2r144 UTSW 6 42216002 missense probably benign 0.01
R1880:Tas2r144 UTSW 6 42216070 missense probably benign 0.02
R4060:Tas2r144 UTSW 6 42215629 missense possibly damaging 0.82
R5173:Tas2r144 UTSW 6 42216114 missense probably benign 0.40
R6108:Tas2r144 UTSW 6 42215757 missense possibly damaging 0.88
R6249:Tas2r144 UTSW 6 42215357 nonsense probably null
R6533:Tas2r144 UTSW 6 42215346 missense probably benign
R6850:Tas2r144 UTSW 6 42215923 missense possibly damaging 0.71
R7237:Tas2r144 UTSW 6 42215866 missense probably damaging 0.99
R7296:Tas2r144 UTSW 6 42215439 missense probably damaging 1.00
R7431:Tas2r144 UTSW 6 42215974 missense probably damaging 1.00
X0067:Tas2r144 UTSW 6 42216165 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCCAGTAACCAAATCCTTTC -3'
(R):5'- GGCATTATGGTTATAAATGATCGGG -3'

Sequencing Primer
(F):5'- AACCTCTTACTTTTAGTCATGTGAC -3'
(R):5'- TGGTTATAAATGATCGGGAAAAGTAG -3'
Posted On2020-07-13