Incidental Mutation 'R8206:Tcf7l1'
ID635910
Institutional Source Beutler Lab
Gene Symbol Tcf7l1
Ensembl Gene ENSMUSG00000055799
Gene Nametranscription factor 7 like 1 (T cell specific, HMG box)
SynonymsTcf3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8206 (G1)
Quality Score212.009
Status Validated
Chromosome6
Chromosomal Location72626378-72789254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72627412 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 583 (L583P)
Ref Sequence ENSEMBL: ENSMUSP00000109687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069536] [ENSMUST00000114053]
Predicted Effect probably damaging
Transcript: ENSMUST00000069536
AA Change: L569P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000069403
Gene: ENSMUSG00000055799
AA Change: L569P

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 248 1.3e-77 PFAM
HMG 342 412 3.47e-21 SMART
low complexity region 418 426 N/A INTRINSIC
low complexity region 427 438 N/A INTRINSIC
low complexity region 475 494 N/A INTRINSIC
low complexity region 510 530 N/A INTRINSIC
low complexity region 536 545 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114053
AA Change: L583P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000109687
Gene: ENSMUSG00000055799
AA Change: L583P

DomainStartEndE-ValueType
Pfam:CTNNB1_binding 1 262 6.9e-91 PFAM
HMG 356 426 3.47e-21 SMART
low complexity region 432 440 N/A INTRINSIC
low complexity region 441 452 N/A INTRINSIC
low complexity region 489 508 N/A INTRINSIC
low complexity region 524 544 N/A INTRINSIC
low complexity region 550 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the T cell factor/lymphoid enhancer factor family of transcription factors. These transcription factors are activated by beta catenin, mediate the Wnt signaling pathway and are antagonized by the transforming growth factor beta signaling pathway. The encoded protein contains a high mobility group-box DNA binding domain and participates in the regulation of cell cycle genes and cellular senescence. [provided by RefSeq, Nov 2010]
PHENOTYPE: Animals homozygous for a targeted mutation exhibit severe embryological defects particularly affecting the cardiovascular system, nervous system, and digestive system. No homozygous embryos survive beyond E11. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Tcf7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02517:Tcf7l1 APN 6 72629983 missense probably benign 0.00
IGL03167:Tcf7l1 APN 6 72632996 missense possibly damaging 0.75
R0731:Tcf7l1 UTSW 6 72788269 missense possibly damaging 0.83
R2679:Tcf7l1 UTSW 6 72627420 missense probably benign 0.43
R2887:Tcf7l1 UTSW 6 72632088 missense probably damaging 1.00
R4015:Tcf7l1 UTSW 6 72636399 intron probably benign
R4433:Tcf7l1 UTSW 6 72788769 missense probably damaging 0.96
R4671:Tcf7l1 UTSW 6 72649178 missense probably damaging 0.99
R5262:Tcf7l1 UTSW 6 72636466 intron probably benign
R5891:Tcf7l1 UTSW 6 72637051 intron probably benign
R6767:Tcf7l1 UTSW 6 72631292 missense probably damaging 0.98
R7255:Tcf7l1 UTSW 6 72627347 splice site probably null
X0027:Tcf7l1 UTSW 6 72788739 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACAGAACAGTCCAGAGTGGTC -3'
(R):5'- TGTGATAGCCCTGCGTCTTC -3'

Sequencing Primer
(F):5'- CAGTCCAGAGTGGTCAAATATTG -3'
(R):5'- TGCGTCTTCCCATGGCAG -3'
Posted On2020-07-13