Incidental Mutation 'R8206:Pde3a'
ID635912
Institutional Source Beutler Lab
Gene Symbol Pde3a
Ensembl Gene ENSMUSG00000041741
Gene Namephosphodiesterase 3A, cGMP inhibited
SynonymsA930022O17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location141249269-141507448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141487885 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 831 (V831A)
Ref Sequence ENSEMBL: ENSMUSP00000038749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043259]
Predicted Effect probably damaging
Transcript: ENSMUST00000043259
AA Change: V831A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000038749
Gene: ENSMUSG00000041741
AA Change: V831A

DomainStartEndE-ValueType
low complexity region 29 43 N/A INTRINSIC
transmembrane domain 60 82 N/A INTRINSIC
low complexity region 93 102 N/A INTRINSIC
low complexity region 103 121 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
transmembrane domain 155 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
transmembrane domain 230 252 N/A INTRINSIC
low complexity region 419 445 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
HDc 749 964 3.76e-4 SMART
low complexity region 1028 1056 N/A INTRINSIC
low complexity region 1114 1133 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cGMP-inhibited cyclic nucleotide phosphodiesterase (cGI-PDE) family. cGI-PDE enzymes hydrolyze both cAMP and cGMP, and play critical roles in many cellular processes by regulating the amplitude and duration of intracellular cyclic nucleotide signals. The encoded protein mediates platelet aggregation and also plays important roles in cardiovascular function by regulating vascular smooth muscle contraction and relaxation. Inhibitors of the encoded protein may be effective in treating congestive heart failure. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous null mice display female infertility with oocyte arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Pde3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Pde3a APN 6 141459738 missense probably damaging 1.00
IGL01400:Pde3a APN 6 141459228 missense probably benign 0.02
IGL01752:Pde3a APN 6 141487613 splice site probably benign
IGL01819:Pde3a APN 6 141487537 missense probably damaging 1.00
IGL02014:Pde3a APN 6 141459144 missense probably null 1.00
IGL02119:Pde3a APN 6 141459803 missense probably damaging 0.97
IGL02465:Pde3a APN 6 141249675 missense possibly damaging 0.53
IGL02677:Pde3a APN 6 141405172 splice site probably benign
IGL02961:Pde3a APN 6 141459700 nonsense probably null
IGL03034:Pde3a APN 6 141492400 splice site probably benign
IGL03142:Pde3a APN 6 141492299 missense probably benign 0.01
PIT4305001:Pde3a UTSW 6 141492310 missense probably benign 0.04
R0412:Pde3a UTSW 6 141498684 missense probably damaging 1.00
R0517:Pde3a UTSW 6 141498657 nonsense probably null
R0573:Pde3a UTSW 6 141492231 missense probably damaging 1.00
R0621:Pde3a UTSW 6 141249999 missense probably damaging 1.00
R0781:Pde3a UTSW 6 141459316 splice site probably benign
R1065:Pde3a UTSW 6 141476732 splice site probably benign
R1110:Pde3a UTSW 6 141459316 splice site probably benign
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1462:Pde3a UTSW 6 141459834 missense probably benign 0.05
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1470:Pde3a UTSW 6 141466206 missense probably benign 0.41
R1480:Pde3a UTSW 6 141487574 missense probably benign 0.17
R1559:Pde3a UTSW 6 141459098 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141250353 missense probably damaging 1.00
R1862:Pde3a UTSW 6 141487513 missense probably damaging 1.00
R1902:Pde3a UTSW 6 141498770 missense probably benign
R1909:Pde3a UTSW 6 141250239 missense probably benign 0.00
R2048:Pde3a UTSW 6 141489006 splice site probably benign
R2144:Pde3a UTSW 6 141490111 missense probably benign 0.40
R2155:Pde3a UTSW 6 141483914 missense possibly damaging 0.70
R2208:Pde3a UTSW 6 141250347 missense probably damaging 0.97
R2405:Pde3a UTSW 6 141481242 missense probably damaging 1.00
R4592:Pde3a UTSW 6 141459216 missense probably benign 0.13
R4677:Pde3a UTSW 6 141466139 missense probably benign 0.02
R4803:Pde3a UTSW 6 141459086 missense probably damaging 1.00
R4887:Pde3a UTSW 6 141470942 missense possibly damaging 0.94
R4999:Pde3a UTSW 6 141250025 missense probably benign 0.00
R5055:Pde3a UTSW 6 141487956 nonsense probably null
R5181:Pde3a UTSW 6 141481255 critical splice donor site probably null
R5640:Pde3a UTSW 6 141483915 missense probably damaging 0.99
R5694:Pde3a UTSW 6 141250502 missense possibly damaging 0.48
R6176:Pde3a UTSW 6 141498889 missense possibly damaging 0.96
R6394:Pde3a UTSW 6 141487511 missense probably damaging 1.00
R6692:Pde3a UTSW 6 141479346 missense probably damaging 1.00
R6968:Pde3a UTSW 6 141487932 missense probably damaging 1.00
R7137:Pde3a UTSW 6 141498746 missense probably benign 0.26
R7163:Pde3a UTSW 6 141487544 missense probably damaging 1.00
R7677:Pde3a UTSW 6 141250257 missense probably damaging 1.00
R7754:Pde3a UTSW 6 141459249 missense probably benign 0.32
R8037:Pde3a UTSW 6 141483924 missense possibly damaging 0.82
R8123:Pde3a UTSW 6 141466191 missense probably benign 0.00
R8262:Pde3a UTSW 6 141487801 missense possibly damaging 0.89
R8376:Pde3a UTSW 6 141481221 missense possibly damaging 0.50
X0053:Pde3a UTSW 6 141483969 splice site probably null
X0062:Pde3a UTSW 6 141249984 missense probably damaging 1.00
Z1177:Pde3a UTSW 6 141250469 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CAGGTAATCCCAGCTTCACAG -3'
(R):5'- CATCTTTGGAAATTAACAAGGCCTC -3'

Sequencing Primer
(F):5'- CCAGCTTCACAGTTTTAAAGAATGCC -3'
(R):5'- GGCCTCTAAAAATTCTGATGACTAGG -3'
Posted On2020-07-13