Incidental Mutation 'R8206:Dpy19l3'
ID635914
Institutional Source Beutler Lab
Gene Symbol Dpy19l3
Ensembl Gene ENSMUSG00000043671
Gene Namedpy-19-like 3 (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R8206 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location35685165-35754454 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35729730 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 95 (Y95C)
Ref Sequence ENSEMBL: ENSMUSP00000054747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051377] [ENSMUST00000144416]
Predicted Effect probably damaging
Transcript: ENSMUST00000051377
AA Change: Y95C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054747
Gene: ENSMUSG00000043671
AA Change: Y95C

DomainStartEndE-ValueType
Pfam:Dpy19 55 712 2.2e-243 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144416
AA Change: Y9C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122489
Gene: ENSMUSG00000043671
AA Change: Y9C

DomainStartEndE-ValueType
Pfam:Dpy19 1 114 2.5e-50 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Sbno1 AGGATACCACTCCATCGAAGTCGTC A 5: 124,402,055 probably benign Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Other mutations in Dpy19l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01066:Dpy19l3 APN 7 35692767 splice site probably benign
IGL01351:Dpy19l3 APN 7 35727415 splice site probably benign
IGL01622:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01623:Dpy19l3 APN 7 35722744 missense probably damaging 1.00
IGL01645:Dpy19l3 APN 7 35695338 missense probably benign 0.00
IGL02725:Dpy19l3 APN 7 35711918 missense probably benign 0.01
IGL02817:Dpy19l3 APN 7 35692808 missense probably damaging 1.00
IGL03130:Dpy19l3 APN 7 35752672 missense probably benign 0.00
IGL03178:Dpy19l3 APN 7 35729729 nonsense probably null
IGL03374:Dpy19l3 APN 7 35712208 missense possibly damaging 0.82
R0143:Dpy19l3 UTSW 7 35714215 missense probably benign 0.19
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0164:Dpy19l3 UTSW 7 35716646 missense probably damaging 0.98
R0385:Dpy19l3 UTSW 7 35752705 missense probably damaging 0.97
R0705:Dpy19l3 UTSW 7 35695316 missense probably damaging 0.96
R1489:Dpy19l3 UTSW 7 35725410 nonsense probably null
R1640:Dpy19l3 UTSW 7 35749778 missense probably benign 0.41
R1782:Dpy19l3 UTSW 7 35708155 missense possibly damaging 0.94
R1843:Dpy19l3 UTSW 7 35729760 missense probably damaging 1.00
R2096:Dpy19l3 UTSW 7 35727288 critical splice donor site probably null
R3814:Dpy19l3 UTSW 7 35727292 nonsense probably null
R4438:Dpy19l3 UTSW 7 35692859 missense probably damaging 1.00
R4537:Dpy19l3 UTSW 7 35711901 missense probably benign 0.01
R4735:Dpy19l3 UTSW 7 35722721 missense probably benign 0.00
R4737:Dpy19l3 UTSW 7 35703501 missense probably damaging 1.00
R4864:Dpy19l3 UTSW 7 35712182 nonsense probably null
R4915:Dpy19l3 UTSW 7 35752742 utr 5 prime probably benign
R4920:Dpy19l3 UTSW 7 35708042 intron probably benign
R5300:Dpy19l3 UTSW 7 35727310 missense probably damaging 1.00
R5527:Dpy19l3 UTSW 7 35714130 missense possibly damaging 0.95
R5801:Dpy19l3 UTSW 7 35725298 missense probably benign 0.10
R6815:Dpy19l3 UTSW 7 35749847 missense possibly damaging 0.67
R7150:Dpy19l3 UTSW 7 35708630 missense probably benign
R7198:Dpy19l3 UTSW 7 35749765 missense possibly damaging 0.73
R7378:Dpy19l3 UTSW 7 35752642 missense probably benign 0.10
R7625:Dpy19l3 UTSW 7 35752681 missense probably benign
R7641:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R7674:Dpy19l3 UTSW 7 35695309 missense probably damaging 1.00
R8034:Dpy19l3 UTSW 7 35749856 missense probably benign
R8073:Dpy19l3 UTSW 7 35729748 missense probably damaging 1.00
R8183:Dpy19l3 UTSW 7 35695389 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAAGAGATGGCTCAGTGAGTAC -3'
(R):5'- TTCTGGTATGTGCAGAGTATCC -3'

Sequencing Primer
(F):5'- CAGTGAGTACAGTCTGATTCCCAG -3'
(R):5'- GGTATGTGCAGAGTATCCTCTCTC -3'
Posted On2020-07-13