Incidental Mutation 'R8206:Inppl1'
ID635915
Institutional Source Beutler Lab
Gene Symbol Inppl1
Ensembl Gene ENSMUSG00000032737
Gene Nameinositol polyphosphate phosphatase-like 1
SynonymsSHIP2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.777) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location101822632-101838229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 101823576 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1207 (I1207T)
Ref Sequence ENSEMBL: ENSMUSP00000048057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008090] [ENSMUST00000035836] [ENSMUST00000165052] [ENSMUST00000185929]
Predicted Effect probably benign
Transcript: ENSMUST00000008090
SMART Domains Protein: ENSMUSP00000008090
Gene: ENSMUSG00000007946

DomainStartEndE-ValueType
low complexity region 40 51 N/A INTRINSIC
HOX 90 152 5.75e-27 SMART
low complexity region 183 223 N/A INTRINSIC
low complexity region 225 244 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000035836
AA Change: I1207T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737
AA Change: I1207T

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000165052
AA Change: I1207T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737
AA Change: I1207T

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185929
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186316
Predicted Effect probably benign
Transcript: ENSMUST00000210116
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice display decreased postnatal growth, decreased circulating levels of leptin, free fatty acids, triglycerides, and total cholesterol, and resistance to diet-induced obesity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nfatc2ip G T 7: 126,390,734 D189E probably damaging Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Inppl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Inppl1 APN 7 101829158 missense probably damaging 1.00
IGL01633:Inppl1 APN 7 101833834 nonsense probably null
IGL01678:Inppl1 APN 7 101832596 missense probably benign 0.09
IGL02420:Inppl1 APN 7 101832319 unclassified probably benign
IGL02423:Inppl1 APN 7 101832243 missense probably benign 0.02
IGL02965:Inppl1 APN 7 101828271 missense possibly damaging 0.87
IGL03329:Inppl1 APN 7 101824380 missense possibly damaging 0.48
ditzel UTSW 7 101827456 nonsense probably null
PIT4362001:Inppl1 UTSW 7 101826013 missense probably benign 0.34
R0310:Inppl1 UTSW 7 101828499 splice site probably benign
R0355:Inppl1 UTSW 7 101827457 missense probably damaging 1.00
R0394:Inppl1 UTSW 7 101828195 splice site probably benign
R0547:Inppl1 UTSW 7 101831003 missense probably benign 0.02
R0578:Inppl1 UTSW 7 101831588 missense probably damaging 1.00
R1506:Inppl1 UTSW 7 101823967 missense probably benign 0.01
R1526:Inppl1 UTSW 7 101832946 missense probably benign 0.02
R1901:Inppl1 UTSW 7 101823377 missense possibly damaging 0.85
R2381:Inppl1 UTSW 7 101829232 missense probably damaging 1.00
R3690:Inppl1 UTSW 7 101832068 missense probably damaging 0.99
R4911:Inppl1 UTSW 7 101832309 missense possibly damaging 0.94
R5637:Inppl1 UTSW 7 101828848 missense probably benign 0.08
R6227:Inppl1 UTSW 7 101824299 missense possibly damaging 0.88
R6409:Inppl1 UTSW 7 101828961 missense probably damaging 1.00
R6678:Inppl1 UTSW 7 101832270 missense probably damaging 0.99
R6752:Inppl1 UTSW 7 101832542 nonsense probably null
R7095:Inppl1 UTSW 7 101827456 nonsense probably null
R7196:Inppl1 UTSW 7 101828786 missense probably benign 0.05
R7421:Inppl1 UTSW 7 101832937 missense probably damaging 0.99
R7575:Inppl1 UTSW 7 101828482 missense probably damaging 1.00
R7664:Inppl1 UTSW 7 101830097 missense probably damaging 0.97
R7767:Inppl1 UTSW 7 101824338 missense probably benign 0.03
R8131:Inppl1 UTSW 7 101830061 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCCAGAAGAAGGCGCTTGTG -3'
(R):5'- TCATTCCCCTTCAGAGCATG -3'

Sequencing Primer
(F):5'- AAGGTCTTCCTCAGTGATGTCAC -3'
(R):5'- ATTCCCCTTCAGAGCATGGGTAG -3'
Posted On2020-07-13