Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Inppl1'

635915

Institutional Source

Beutler Lab

Gene Symbol

Inppl1

Ensembl Gene

ENSMUSG00000032737

Gene Name

inositol polyphosphate phosphatase-like 1

Synonyms

SHIP2

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.812) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101822632-101838229 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 101823576 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 1207 (I1207T)

Ref Sequence

ENSEMBL: ENSMUSP00000048057 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008090] [ENSMUST00000035836] [ENSMUST00000165052] [ENSMUST00000185929]

AlphaFold

Q6P549

Predicted Effect

probably benign
Transcript: ENSMUST00000008090

SMART Domains

Protein: ENSMUSP00000008090
Gene: ENSMUSG00000007946

Domain	Start	End	E-Value	Type
low complexity region	40	51	N/A	INTRINSIC
HOX	90	152	5.75e-27	SMART
low complexity region	183	223	N/A	INTRINSIC
low complexity region	225	244	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035836
AA Change: I1207T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737
AA Change: I1207T

Domain	Start	End	E-Value	Type
SH2	19	108	1.21e-26	SMART
low complexity region	116	137	N/A	INTRINSIC
low complexity region	156	175	N/A	INTRINSIC
Blast:IPPc	250	349	5e-14	BLAST
IPPc	423	736	3.98e-137	SMART
low complexity region	934	957	N/A	INTRINSIC
low complexity region	997	1013	N/A	INTRINSIC
low complexity region	1036	1047	N/A	INTRINSIC
low complexity region	1049	1068	N/A	INTRINSIC
low complexity region	1089	1102	N/A	INTRINSIC
SAM	1192	1257	2.47e-8	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165052
AA Change: I1207T

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737
AA Change: I1207T

Domain	Start	End	E-Value	Type
SH2	19	108	1.21e-26	SMART
low complexity region	116	137	N/A	INTRINSIC
low complexity region	156	175	N/A	INTRINSIC
Blast:IPPc	250	349	5e-14	BLAST
IPPc	423	736	3.98e-137	SMART
low complexity region	934	957	N/A	INTRINSIC
low complexity region	997	1013	N/A	INTRINSIC
low complexity region	1036	1047	N/A	INTRINSIC
low complexity region	1049	1068	N/A	INTRINSIC
low complexity region	1089	1102	N/A	INTRINSIC
SAM	1192	1257	2.47e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000185929

SMART Domains

Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737

Domain	Start	End	E-Value	Type
SH2	19	108	7.6e-29	SMART
low complexity region	116	137	N/A	INTRINSIC
low complexity region	156	175	N/A	INTRINSIC
Blast:IPPc	250	349	4e-14	BLAST
IPPc	423	736	1.9e-139	SMART
low complexity region	934	957	N/A	INTRINSIC
low complexity region	997	1013	N/A	INTRINSIC
low complexity region	1036	1047	N/A	INTRINSIC
low complexity region	1049	1068	N/A	INTRINSIC
low complexity region	1089	1102	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186316

Predicted Effect

probably benign
Transcript: ENSMUST00000210116

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SH2-containing 5'-inositol phosphatase that is involved in the regulation of insulin function. The encoded protein also plays a role in the regulation of epidermal growth factor receptor turnover and actin remodelling. Additionally, this gene supports metastatic growth in breast cancer and is a valuable biomarker for breast cancer. [provided by RefSeq, Jan 2009]
PHENOTYPE: Homozygous mice display decreased postnatal growth, decreased circulating levels of leptin, free fatty acids, triglycerides, and total cholesterol, and resistance to diet-induced obesity. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Inppl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Inppl1	APN	7	101829158	missense	probably damaging	1.00
IGL01633:Inppl1	APN	7	101833834	nonsense	probably null
IGL01678:Inppl1	APN	7	101832596	missense	probably benign	0.09
IGL02420:Inppl1	APN	7	101832319	unclassified	probably benign
IGL02423:Inppl1	APN	7	101832243	missense	probably benign	0.02
IGL02965:Inppl1	APN	7	101828271	missense	possibly damaging	0.87
IGL03329:Inppl1	APN	7	101824380	missense	possibly damaging	0.48
ditzel	UTSW	7	101827456	nonsense	probably null
PIT4362001:Inppl1	UTSW	7	101826013	missense	probably benign	0.34
R0310:Inppl1	UTSW	7	101828499	splice site	probably benign
R0355:Inppl1	UTSW	7	101827457	missense	probably damaging	1.00
R0394:Inppl1	UTSW	7	101828195	splice site	probably benign
R0547:Inppl1	UTSW	7	101831003	missense	probably benign	0.02
R0578:Inppl1	UTSW	7	101831588	missense	probably damaging	1.00
R1506:Inppl1	UTSW	7	101823967	missense	probably benign	0.01
R1526:Inppl1	UTSW	7	101832946	missense	probably benign	0.02
R1901:Inppl1	UTSW	7	101823377	missense	possibly damaging	0.85
R2381:Inppl1	UTSW	7	101829232	missense	probably damaging	1.00
R3690:Inppl1	UTSW	7	101832068	missense	probably damaging	0.99
R4911:Inppl1	UTSW	7	101832309	missense	possibly damaging	0.94
R5637:Inppl1	UTSW	7	101828848	missense	probably benign	0.08
R6227:Inppl1	UTSW	7	101824299	missense	possibly damaging	0.88
R6409:Inppl1	UTSW	7	101828961	missense	probably damaging	1.00
R6678:Inppl1	UTSW	7	101832270	missense	probably damaging	0.99
R6752:Inppl1	UTSW	7	101832542	nonsense	probably null
R7095:Inppl1	UTSW	7	101827456	nonsense	probably null
R7196:Inppl1	UTSW	7	101828786	missense	probably benign	0.05
R7421:Inppl1	UTSW	7	101832937	missense	probably damaging	0.99
R7575:Inppl1	UTSW	7	101828482	missense	probably damaging	1.00
R7664:Inppl1	UTSW	7	101830097	missense	probably damaging	0.97
R7767:Inppl1	UTSW	7	101824338	missense	probably benign	0.03
R8131:Inppl1	UTSW	7	101830061	missense	possibly damaging	0.50
R8492:Inppl1	UTSW	7	101826778	missense	probably damaging	1.00
R8559:Inppl1	UTSW	7	101829627	nonsense	probably null
R8707:Inppl1	UTSW	7	101829696	missense
R8876:Inppl1	UTSW	7	101823543	missense	possibly damaging	0.71
R8921:Inppl1	UTSW	7	101823386	missense	possibly damaging	0.92
R9021:Inppl1	UTSW	7	101831708	missense	probably damaging	0.96
R9113:Inppl1	UTSW	7	101826024	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- TCCAGAAGAAGGCGCTTGTG -3'
(R):5'- TCATTCCCCTTCAGAGCATG -3'

Sequencing Primer
(F):5'- AAGGTCTTCCTCAGTGATGTCAC -3'
(R):5'- ATTCCCCTTCAGAGCATGGGTAG -3'

Posted On

2020-07-13