Incidental Mutation 'R8206:Nfatc2ip'
ID635916
Institutional Source Beutler Lab
Gene Symbol Nfatc2ip
Ensembl Gene ENSMUSG00000030722
Gene Namenuclear factor of activated T cells, cytoplasmic, calcineurin dependent 2 interacting protein
SynonymsNIP45, D7Ertd304e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.194) question?
Stock #R8206 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location126382854-126396737 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 126390734 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 189 (D189E)
Ref Sequence ENSEMBL: ENSMUSP00000075094 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075671]
PDB Structure
The crystal structure of SUMO-like domain 2 in Nip45 [X-RAY DIFFRACTION]
The crystal structure of the SLD2:Ubc9 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000075671
AA Change: D189E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075094
Gene: ENSMUSG00000030722
AA Change: D189E

DomainStartEndE-ValueType
low complexity region 6 32 N/A INTRINSIC
low complexity region 43 58 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
coiled coil region 199 227 N/A INTRINSIC
UBQ 258 328 1.31e-8 SMART
low complexity region 329 338 N/A INTRINSIC
Pfam:Rad60-SLD 341 411 3.6e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142947
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (50/50)
MGI Phenotype PHENOTYPE: Homozygous null mice display profound defects in the expression of NFAT-regulated cytokine genes and defects in the efficient handling of parasites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110F15Rik A T 9: 35,839,423 F34L possibly damaging Het
Ano4 A G 10: 89,025,096 Y342H probably damaging Het
Aqp4 T A 18: 15,393,659 D255V possibly damaging Het
Arhgap26 C A 18: 39,306,750 S247* probably null Het
Arid4a A G 12: 71,086,587 D1154G probably damaging Het
Atpaf2 A G 11: 60,404,478 I182T probably damaging Het
Cacna1i C A 15: 80,389,815 probably null Het
Ccdc38 A G 10: 93,563,284 S205G probably damaging Het
Cep63 A G 9: 102,621,271 probably benign Het
Cyp24a1 T C 2: 170,491,669 T255A possibly damaging Het
Dlg5 A G 14: 24,160,268 S787P possibly damaging Het
Dnah6 A T 6: 73,037,566 C3679* probably null Het
Dpy19l3 T C 7: 35,729,730 Y95C probably damaging Het
Erc2 G A 14: 28,303,015 probably null Het
Ezh2 A T 6: 47,532,900 probably null Het
Fgfr1 A G 8: 25,570,242 T463A probably damaging Het
Fsip2 T C 2: 82,990,464 S5514P possibly damaging Het
Glrb A G 3: 80,851,066 Y347H probably damaging Het
Gm14325 C A 2: 177,832,974 C105F probably damaging Het
Hgsnat T C 8: 25,954,637 T428A probably damaging Het
Ighv1-76 T C 12: 115,848,314 M1V probably null Het
Inppl1 A G 7: 101,823,576 I1207T possibly damaging Het
Kmt2c T A 5: 25,314,539 Q2191L probably damaging Het
Krt79 T A 15: 101,940,270 probably null Het
Mast4 G A 13: 102,735,739 L2374F probably damaging Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Mgam A G 6: 40,680,235 N951S probably benign Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Naip6 A T 13: 100,294,836 C1164* probably null Het
Nrp1 A G 8: 128,457,957 D361G probably damaging Het
Nrp2 T C 1: 62,747,215 I293T probably damaging Het
Pde3a T C 6: 141,487,885 V831A probably damaging Het
Pirb A G 7: 3,712,906 probably null Het
Plch1 G T 3: 63,702,626 probably null Het
Plekhh2 A G 17: 84,590,849 T973A possibly damaging Het
Ppp1r35 T A 5: 137,780,034 I97K unknown Het
Ppp1r3c C T 19: 36,733,446 G308E probably benign Het
Prss12 G A 3: 123,464,962 probably null Het
Rad51b A G 12: 79,314,941 D142G probably damaging Het
Slc13a3 C T 2: 165,406,825 G553D probably damaging Het
Spata31d1d A C 13: 59,731,530 V64G probably benign Het
Srp68 G A 11: 116,273,983 R42C probably damaging Het
Syne2 T C 12: 76,015,591 V4229A probably benign Het
Tas2r144 G A 6: 42,215,391 V22M probably damaging Het
Tcf7l1 A G 6: 72,627,412 L583P probably damaging Het
Tdgf1 G A 9: 110,944,284 probably benign Het
Tdrd3 A G 14: 87,511,778 D708G probably benign Het
Tns4 A T 11: 99,085,801 L98Q probably damaging Het
Zfp677 T A 17: 21,392,455 probably null Het
Other mutations in Nfatc2ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02106:Nfatc2ip APN 7 126390564 splice site probably null
IGL03137:Nfatc2ip APN 7 126390568 missense possibly damaging 0.77
Weissgott UTSW 7 126396010 missense possibly damaging 0.80
R0136:Nfatc2ip UTSW 7 126391335 missense probably benign 0.11
R0521:Nfatc2ip UTSW 7 126396579 missense possibly damaging 0.93
R0657:Nfatc2ip UTSW 7 126391335 missense probably benign 0.11
R1610:Nfatc2ip UTSW 7 126387407 missense probably damaging 0.99
R1768:Nfatc2ip UTSW 7 126390462 missense probably benign 0.00
R1932:Nfatc2ip UTSW 7 126384992 missense probably damaging 1.00
R2116:Nfatc2ip UTSW 7 126385108 missense probably damaging 1.00
R2130:Nfatc2ip UTSW 7 126390462 missense probably benign 0.00
R2202:Nfatc2ip UTSW 7 126391295 missense probably benign 0.01
R2350:Nfatc2ip UTSW 7 126395998 missense probably benign 0.30
R4946:Nfatc2ip UTSW 7 126396612 missense possibly damaging 0.79
R5545:Nfatc2ip UTSW 7 126390470 missense possibly damaging 0.86
R6229:Nfatc2ip UTSW 7 126395941 critical splice donor site probably null
R6460:Nfatc2ip UTSW 7 126387737 missense probably damaging 1.00
R6741:Nfatc2ip UTSW 7 126396010 missense possibly damaging 0.80
R7355:Nfatc2ip UTSW 7 126387611 critical splice donor site probably null
R7912:Nfatc2ip UTSW 7 126390445 nonsense probably null
R8004:Nfatc2ip UTSW 7 126390405 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GTTCACTTCCCTGGGTATGGAC -3'
(R):5'- AGTGCCTGGTGTAATGTTGAAC -3'

Sequencing Primer
(F):5'- ACTTCCCTGGGTATGGACAAGAC -3'
(R):5'- GCCTGGTGTAATGTTGAACAATTGAC -3'
Posted On2020-07-13