Mutagenetix > Incidental Mutation

Incidental Mutation 'R8206:Fgfr1'

635917

Institutional Source

Beutler Lab

Gene Symbol

Fgfr1

Ensembl Gene

ENSMUSG00000031565

Gene Name

fibroblast growth factor receptor 1

Synonyms

Eask, Hspy, Fgfr-1, Flt-2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25513654-25575718 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 25570242 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 463 (T463A)

Ref Sequence

ENSEMBL: ENSMUSP00000113855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000084027] [ENSMUST00000117179] [ENSMUST00000119398] [ENSMUST00000167764] [ENSMUST00000178276] [ENSMUST00000179592]

AlphaFold

P16092

Predicted Effect

probably damaging
Transcript: ENSMUST00000084027
AA Change: T552A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000081041
Gene: ENSMUSG00000031565
AA Change: T552A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	46	108	2.94e-10	SMART
low complexity region	124	138	N/A	INTRINSIC
IGc2	169	237	4.09e-9	SMART
IGc2	268	348	1.26e-9	SMART
transmembrane domain	375	397	N/A	INTRINSIC
low complexity region	439	453	N/A	INTRINSIC
TyrKc	478	754	1.51e-155	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117179
AA Change: T550A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113909
Gene: ENSMUSG00000031565
AA Change: T550A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	46	108	2.94e-10	SMART
low complexity region	124	138	N/A	INTRINSIC
IGc2	167	235	4.09e-9	SMART
IGc2	266	346	1.26e-9	SMART
transmembrane domain	373	395	N/A	INTRINSIC
low complexity region	437	451	N/A	INTRINSIC
TyrKc	476	752	1.51e-155	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000119398
AA Change: T463A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113855
Gene: ENSMUSG00000031565
AA Change: T463A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	35	49	N/A	INTRINSIC
IGc2	80	148	4.09e-9	SMART
IGc2	179	259	1.26e-9	SMART
transmembrane domain	286	308	N/A	INTRINSIC
low complexity region	350	364	N/A	INTRINSIC
TyrKc	389	665	1.51e-155	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000138104

Predicted Effect

probably damaging
Transcript: ENSMUST00000167764
AA Change: T463A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000131343
Gene: ENSMUSG00000031565
AA Change: T463A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	35	49	N/A	INTRINSIC
IGc2	78	146	4.09e-9	SMART
IGc2	177	255	1.22e-7	SMART
transmembrane domain	286	308	N/A	INTRINSIC
low complexity region	350	364	N/A	INTRINSIC
TyrKc	389	665	1.51e-155	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000178276
AA Change: T463A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000137515
Gene: ENSMUSG00000031565
AA Change: T463A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
low complexity region	35	49	N/A	INTRINSIC
IGc2	78	146	4.09e-9	SMART
IGc2	177	255	1.22e-7	SMART
transmembrane domain	286	308	N/A	INTRINSIC
low complexity region	350	364	N/A	INTRINSIC
TyrKc	389	665	1.51e-155	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179592
AA Change: T563A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000136640
Gene: ENSMUSG00000031565
AA Change: T563A

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGc2	59	121	2.94e-10	SMART
low complexity region	137	151	N/A	INTRINSIC
IGc2	180	248	4.09e-9	SMART
IGc2	279	359	1.26e-9	SMART
transmembrane domain	386	408	N/A	INTRINSIC
low complexity region	450	464	N/A	INTRINSIC
TyrKc	489	765	1.51e-155	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member binds both acidic and basic fibroblast growth factors and is involved in limb induction. Mutations in this gene have been associated with Pfeiffer syndrome, Jackson-Weiss syndrome, Antley-Bixler syndrome, osteoglophonic dysplasia, and autosomal dominant Kallmann syndrome 2. Chromosomal aberrations involving this gene are associated with stem cell myeloproliferative disorder and stem cell leukemia lymphoma syndrome. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die around gastrulation and show defective patterning of axial structures. Hypomorphic and selectively ablated mutations exhibit a wide range of abnormalities affecting diverse structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Flvcr2	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Hgsnat	T	C	8: 25,954,637	T428A	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Fgfr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01413:Fgfr1	APN	8	25562223	nonsense	probably null
IGL01537:Fgfr1	APN	8	25555579	missense	probably damaging	1.00
IGL01643:Fgfr1	APN	8	25566735	missense	probably benign	0.01
IGL01875:Fgfr1	APN	8	25573553	missense	possibly damaging	0.81
IGL02002:Fgfr1	APN	8	25555711	missense	probably damaging	1.00
IGL02698:Fgfr1	APN	8	25573608	nonsense	probably null
IGL02822:Fgfr1	APN	8	25557802	missense	probably benign	0.13
IGL03292:Fgfr1	APN	8	25557755	missense	possibly damaging	0.50
R0003:Fgfr1	UTSW	8	25568198	missense	possibly damaging	0.80
R0723:Fgfr1	UTSW	8	25557768	missense	probably damaging	0.99
R0730:Fgfr1	UTSW	8	25555744	missense	probably benign
R1144:Fgfr1	UTSW	8	25558143	missense	probably damaging	1.00
R1455:Fgfr1	UTSW	8	25562276	missense	possibly damaging	0.81
R1591:Fgfr1	UTSW	8	25572720	missense	probably damaging	1.00
R1754:Fgfr1	UTSW	8	25570210	missense	probably damaging	1.00
R2045:Fgfr1	UTSW	8	25558215	missense	probably benign	0.04
R2139:Fgfr1	UTSW	8	25570866	missense	probably damaging	1.00
R2314:Fgfr1	UTSW	8	25570893	missense	probably damaging	1.00
R2517:Fgfr1	UTSW	8	25563446	missense	probably damaging	1.00
R2982:Fgfr1	UTSW	8	25558211	missense	probably benign	0.04
R3796:Fgfr1	UTSW	8	25572437	missense	probably damaging	1.00
R3797:Fgfr1	UTSW	8	25572437	missense	probably damaging	1.00
R3799:Fgfr1	UTSW	8	25572437	missense	probably damaging	1.00
R4323:Fgfr1	UTSW	8	25573899	missense	probably benign	0.37
R4594:Fgfr1	UTSW	8	25573836	missense	probably damaging	0.99
R4614:Fgfr1	UTSW	8	25557797	missense	probably benign	0.25
R4696:Fgfr1	UTSW	8	25563488	missense	probably damaging	0.99
R4916:Fgfr1	UTSW	8	25563526	critical splice donor site	probably null
R4966:Fgfr1	UTSW	8	25572445	nonsense	probably null
R5094:Fgfr1	UTSW	8	25570165	missense	probably damaging	1.00
R5730:Fgfr1	UTSW	8	25573811	missense	probably damaging	1.00
R5911:Fgfr1	UTSW	8	25519309	utr 5 prime	probably benign
R7310:Fgfr1	UTSW	8	25562315	missense	probably benign	0.01
R7326:Fgfr1	UTSW	8	25573839	missense	probably damaging	1.00
R7404:Fgfr1	UTSW	8	25555550	missense	probably benign
R7611:Fgfr1	UTSW	8	25558205	nonsense	probably null
R7681:Fgfr1	UTSW	8	25555661	missense	probably damaging	0.98
R7738:Fgfr1	UTSW	8	25558185	missense	probably damaging	0.96
R7789:Fgfr1	UTSW	8	25562313	nonsense	probably null
R7958:Fgfr1	UTSW	8	25532342	missense	probably benign
R8236:Fgfr1	UTSW	8	25562272	nonsense	probably null
R8691:Fgfr1	UTSW	8	25562237	missense	possibly damaging	0.95
R9124:Fgfr1	UTSW	8	25570169	missense	probably damaging	1.00
R9633:Fgfr1	UTSW	8	25570760	missense	probably damaging	1.00
R9704:Fgfr1	UTSW	8	25573563	missense	probably benign	0.01
R9798:Fgfr1	UTSW	8	25563507	missense	unknown
Z1177:Fgfr1	UTSW	8	25563398	missense	probably benign	0.00
Z1177:Fgfr1	UTSW	8	25570768	missense	possibly damaging	0.67

Predicted Primers

PCR Primer
(F):5'- ACATGGTAGTAGTGGCTCCTG -3'
(R):5'- GGTAGGTGCCCTAATGTAGAC -3'

Sequencing Primer
(F):5'- TCCTGGAGAAAAGGGGGCTC -3'
(R):5'- GGTGCCCTAATGTAGACTCTATTAAC -3'

Posted On

2020-07-13