Mutagenetix > Incidental Mutations

Incidental Mutation 'R8206:Hgsnat'

635918

Institutional Source

Beutler Lab

Gene Symbol

Hgsnat

Ensembl Gene

ENSMUSG00000037260

Gene Name

heparan-alpha-glucosaminide N-acetyltransferase

Synonyms

D8Ertd354e, 9430010M12Rik, Tmem76

MMRRC Submission

Accession Numbers

Ncbi RefSeq: NM_029884.1; MGI:1196297

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8206 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

25944453-25976753 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 25954637 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 428 (T428A)

Ref Sequence

ENSEMBL: ENSMUSP00000040356 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037609]

Predicted Effect

probably damaging
Transcript: ENSMUST00000037609
AA Change: T428A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000040356
Gene: ENSMUSG00000037260
AA Change: T428A

Domain	Start	End	E-Value	Type
low complexity region	2	23	N/A	INTRINSIC
transmembrane domain	33	55	N/A	INTRINSIC
transmembrane domain	189	211	N/A	INTRINSIC
Pfam:DUF1624	260	434	6.8e-11	PFAM
Pfam:DUF5009	286	389	2.4e-10	PFAM
transmembrane domain	494	516	N/A	INTRINSIC
transmembrane domain	523	545	N/A	INTRINSIC
transmembrane domain	560	582	N/A	INTRINSIC
transmembrane domain	587	609	N/A	INTRINSIC
transmembrane domain	629	648	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a lysosomal acetyltransferase, which is one of several enzymes involved in the lysosomal degradation of heparin sulfate. Mutations in this gene are associated with Sanfilippo syndrome C, one type of the lysosomal storage disease mucopolysaccaridosis III, which results from impaired degradation of heparan sulfate. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit progressive storage pathology in the CNS and peripheral organs, glycosaminoglycan accumulation in brain and most somatic organs, lysosomal distension and dysfunction, astrocytosis, microgliosis, hepatosplenomegaly, behavioral deficits and premature death. [provided by MGI curators]

Allele List at MGI

All alleles(9) : Targeted(3) Gene trapped(6)

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110F15Rik	A	T	9: 35,839,423	F34L	possibly damaging	Het
Ano4	A	G	10: 89,025,096	Y342H	probably damaging	Het
Aqp4	T	A	18: 15,393,659	D255V	possibly damaging	Het
Arhgap26	C	A	18: 39,306,750	S247*	probably null	Het
Arid4a	A	G	12: 71,086,587	D1154G	probably damaging	Het
Atpaf2	A	G	11: 60,404,478	I182T	probably damaging	Het
Cacna1i	C	A	15: 80,389,815		probably null	Het
Ccdc38	A	G	10: 93,563,284	S205G	probably damaging	Het
Cep63	A	G	9: 102,621,271		probably benign	Het
Cyp24a1	T	C	2: 170,491,669	T255A	possibly damaging	Het
Dlg5	A	G	14: 24,160,268	S787P	possibly damaging	Het
Dnah6	A	T	6: 73,037,566	C3679*	probably null	Het
Dpy19l3	T	C	7: 35,729,730	Y95C	probably damaging	Het
Erc2	G	A	14: 28,303,015		probably null	Het
Ezh2	A	T	6: 47,532,900		probably null	Het
Fgfr1	A	G	8: 25,570,242	T463A	probably damaging	Het
Fsip2	T	C	2: 82,990,464	S5514P	possibly damaging	Het
Glrb	A	G	3: 80,851,066	Y347H	probably damaging	Het
Gm14325	C	A	2: 177,832,974	C105F	probably damaging	Het
Ighv1-76	T	C	12: 115,848,314	M1V	probably null	Het
Inppl1	A	G	7: 101,823,576	I1207T	possibly damaging	Het
Kmt2c	T	A	5: 25,314,539	Q2191L	probably damaging	Het
Krt79	T	A	15: 101,940,270		probably null	Het
Mast4	G	A	13: 102,735,739	L2374F	probably damaging	Het
Mfsd7c	GTAGTGTATA	GTA	12: 85,803,148		probably null	Het
Mgam	A	G	6: 40,680,235	N951S	probably benign	Het
Myl10	G	C	5: 136,697,971	V70L	probably benign	Het
Naip6	A	T	13: 100,294,836	C1164*	probably null	Het
Nfatc2ip	G	T	7: 126,390,734	D189E	probably damaging	Het
Nrp1	A	G	8: 128,457,957	D361G	probably damaging	Het
Nrp2	T	C	1: 62,747,215	I293T	probably damaging	Het
Pde3a	T	C	6: 141,487,885	V831A	probably damaging	Het
Pirb	A	G	7: 3,712,906		probably null	Het
Plch1	G	T	3: 63,702,626		probably null	Het
Plekhh2	A	G	17: 84,590,849	T973A	possibly damaging	Het
Ppp1r35	T	A	5: 137,780,034	I97K	unknown	Het
Ppp1r3c	C	T	19: 36,733,446	G308E	probably benign	Het
Prss12	G	A	3: 123,464,962		probably null	Het
Rad51b	A	G	12: 79,314,941	D142G	probably damaging	Het
Slc13a3	C	T	2: 165,406,825	G553D	probably damaging	Het
Spata31d1d	A	C	13: 59,731,530	V64G	probably benign	Het
Srp68	G	A	11: 116,273,983	R42C	probably damaging	Het
Syne2	T	C	12: 76,015,591	V4229A	probably benign	Het
Tas2r144	G	A	6: 42,215,391	V22M	probably damaging	Het
Tcf7l1	A	G	6: 72,627,412	L583P	probably damaging	Het
Tdgf1	G	A	9: 110,944,284		probably benign	Het
Tdrd3	A	G	14: 87,511,778	D708G	probably benign	Het
Tns4	A	T	11: 99,085,801	L98Q	probably damaging	Het
Zfp677	T	A	17: 21,392,455		probably null	Het

Other mutations in Hgsnat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00661:Hgsnat	APN	8	25972937	missense	probably benign	0.04
IGL02950:Hgsnat	APN	8	25971701	missense	probably damaging	1.00
IGL03145:Hgsnat	APN	8	25946452	missense	probably damaging	1.00
ample	UTSW	8	25947960	nonsense	probably null
generous	UTSW	8	25968361	critical splice donor site	probably null
P0018:Hgsnat	UTSW	8	25968354	unclassified	probably benign
PIT4305001:Hgsnat	UTSW	8	25945199	missense	possibly damaging	0.67
R1396:Hgsnat	UTSW	8	25957335	missense	possibly damaging	0.95
R1676:Hgsnat	UTSW	8	25954605	critical splice donor site	probably null
R1856:Hgsnat	UTSW	8	25957256	missense	probably benign	0.06
R1998:Hgsnat	UTSW	8	25945252	nonsense	probably null
R2497:Hgsnat	UTSW	8	25945252	nonsense	probably null
R2570:Hgsnat	UTSW	8	25945252	nonsense	probably null
R4012:Hgsnat	UTSW	8	25955789	nonsense	probably null
R4080:Hgsnat	UTSW	8	25946343	missense	probably benign	0.02
R4462:Hgsnat	UTSW	8	25954636	missense	probably damaging	1.00
R4523:Hgsnat	UTSW	8	25968361	critical splice donor site	probably null
R4914:Hgsnat	UTSW	8	25964838	missense	probably damaging	0.98
R5010:Hgsnat	UTSW	8	25947960	nonsense	probably null
R5561:Hgsnat	UTSW	8	25946334	missense	possibly damaging	0.90
R5889:Hgsnat	UTSW	8	25963367	missense	probably damaging	1.00
R6411:Hgsnat	UTSW	8	25946275	missense	possibly damaging	0.88
R6520:Hgsnat	UTSW	8	25953300	missense	probably damaging	1.00
R6524:Hgsnat	UTSW	8	25945232	missense	probably damaging	1.00
R7230:Hgsnat	UTSW	8	25954832	splice site	probably null
R7462:Hgsnat	UTSW	8	25957213	missense	probably benign	0.45
R7509:Hgsnat	UTSW	8	25955726	missense	probably damaging	0.98
R7526:Hgsnat	UTSW	8	25971049	missense	probably damaging	1.00
R7583:Hgsnat	UTSW	8	25971564	critical splice donor site	probably null
R7679:Hgsnat	UTSW	8	25954637	missense	probably damaging	1.00
R8111:Hgsnat	UTSW	8	25968412	missense	probably benign	0.00
R8321:Hgsnat	UTSW	8	25971151	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- CCATGCATGGTGGTACATATTTG -3'
(R):5'- CGCATCTCCATGTATACTTGTGTG -3'

Sequencing Primer
(F):5'- AATATCAGCAGGTGGATCCTTTGGAC -3'
(R):5'- CTCAGAGATCTACACTGGGGTTAC -3'

Posted On

2020-07-13